EMAIL THIS PAGE TO A FRIEND

LRIT1

leucine-rich repeat, immunoglobulin-like and transmembrane domains 1

52 Gene Product Result for
Synonyms: FIGLER9 LRRC21 PAL
UniProtKB ID: Q9P2V4, Q9Y4N7
Gene ID:
Mouse(239037) leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Rat(246214) leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
chicken(428935) leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
cow(538858) leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Horse(100052636) leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
domestic cat(101082780) leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
dog(100683818) leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
sheep(101113563) leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
domestic guinea pig(100727011) leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Domestic Rabbit(100357265) leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
naked mole-rat(101706242) leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015613 Rosetta Predictions human pricing
NM_139331 Rosetta Predictions rat pricing
NM_146245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125864 predicted 1060
2 SASI_Hs01_00125866 predicted 1426
3 SASI_Hs01_00125868 predicted 1298
4 SASI_Hs01_00125871 predicted 681
5 SASI_Hs02_00348208 predicted 596
6 SASI_Hs01_00125872 predicted 550
7 SASI_Hs02_00348209 predicted 1723
8 SASI_Hs02_00348210 predicted 626
9 SASI_Hs02_00348211 predicted 971
10 SASI_Hs02_00348212 predicted 738
11 SASI_Hs01_00125865 predicted 698
12 SASI_Hs01_00125867 predicted 1494
13 SASI_Hs01_00125869 predicted 1688
14 SASI_Hs01_00125870 predicted 1043
15 SASI_Hs01_00125873 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043238 predicted 1436
2 SASI_Rn02_00268592 predicted 2024
3 SASI_Rn01_00043240 predicted 1170
4 SASI_Rn02_00268593 predicted 2020
5 SASI_Rn02_00268594 predicted 1325
6 SASI_Rn01_00043241 predicted 1006
7 SASI_Rn01_00043242 predicted 848
8 SASI_Rn01_00043244 predicted 2012
9 SASI_Rn01_00043245 predicted 1341
10 SASI_Rn01_00043246 predicted 1376
11 SASI_Rn01_00043237 predicted 332
12 SASI_Rn01_00043239 predicted 726
13 SASI_Rn01_00043243 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108942 predicted 2069
2 SASI_Mm01_00108943 predicted 1395
3 SASI_Mm01_00108944 predicted 1633
4 SASI_Mm01_00108945 predicted 1011
5 SASI_Mm01_00108946 predicted 1469
6 SASI_Mm01_00108947 predicted 1110
7 SASI_Mm01_00108948 predicted 1373
8 SASI_Mm01_00108949 predicted 366
9 SASI_Mm01_00108950 predicted 1946
10 SASI_Mm01_00108951 predicted 1405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015613
LRIT1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015613.2-561s21c1
Sequence:CCGGACCTGGAGACCGGTATCTTTCCTCGAGGAAAGATACCGGTCTCCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015613.2-2046s21c1
Sequence:CCGGCAACCGCTAACACTTGTTAAGCTCGAGCTTAACAAGTGTTAGCGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015613.2-1824s21c1
Sequence:CCGGCTCGTTCCAGTGTGGACTTTCCTCGAGGAAAGTCCACACTGGAACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1486s1c1
Sequence:CCGGGTTGCCCAAGACCAAGTATGTCTCGAGACATACTTGGTCTTGGGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1384s1c1
Sequence:CCGGGAACACAACTGCCTTCAGTGTCTCGAGACACTGAAGGCAGTTGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015613.1-1000s1c1
Sequence:CCGGCATCTGCCAAGCCAAGAACTTCTCGAGAAGTTCTTGGCTTGGCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1040s1c1
Sequence:CCGGGTTATCTCCTTGATTGTCACTCTCGAGAGTGACAATCAAGGAGATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1600s1c1
Sequence:CCGGGCTTATCAATGTGGTGGTGATCTCGAGATCACCACCACATTGATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-688s1c1
Sequence:CCGGCTTGGCCTTCATTGAGACTGACTCGAGTCAGTCTCAATGAAGGCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015613
LRIT1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015613.2-561s21c1
Sequence:CCGGACCTGGAGACCGGTATCTTTCCTCGAGGAAAGATACCGGTCTCCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015613.2-2046s21c1
Sequence:CCGGCAACCGCTAACACTTGTTAAGCTCGAGCTTAACAAGTGTTAGCGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015613.2-1824s21c1
Sequence:CCGGCTCGTTCCAGTGTGGACTTTCCTCGAGGAAAGTCCACACTGGAACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1486s1c1
Sequence:CCGGGTTGCCCAAGACCAAGTATGTCTCGAGACATACTTGGTCTTGGGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1384s1c1
Sequence:CCGGGAACACAACTGCCTTCAGTGTCTCGAGACACTGAAGGCAGTTGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015613.1-1000s1c1
Sequence:CCGGCATCTGCCAAGCCAAGAACTTCTCGAGAAGTTCTTGGCTTGGCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1040s1c1
Sequence:CCGGGTTATCTCCTTGATTGTCACTCTCGAGAGTGACAATCAAGGAGATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1600s1c1
Sequence:CCGGGCTTATCAATGTGGTGGTGATCTCGAGATCACCACCACATTGATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-688s1c1
Sequence:CCGGCTTGGCCTTCATTGAGACTGACTCGAGTCAGTCTCAATGAAGGCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015613
LRIT1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015613.2-561s21c1
Sequence:CCGGACCTGGAGACCGGTATCTTTCCTCGAGGAAAGATACCGGTCTCCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015613.2-2046s21c1
Sequence:CCGGCAACCGCTAACACTTGTTAAGCTCGAGCTTAACAAGTGTTAGCGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015613.2-1824s21c1
Sequence:CCGGCTCGTTCCAGTGTGGACTTTCCTCGAGGAAAGTCCACACTGGAACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1486s1c1
Sequence:CCGGGTTGCCCAAGACCAAGTATGTCTCGAGACATACTTGGTCTTGGGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1384s1c1
Sequence:CCGGGAACACAACTGCCTTCAGTGTCTCGAGACACTGAAGGCAGTTGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015613.1-1000s1c1
Sequence:CCGGCATCTGCCAAGCCAAGAACTTCTCGAGAAGTTCTTGGCTTGGCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1040s1c1
Sequence:CCGGGTTATCTCCTTGATTGTCACTCTCGAGAGTGACAATCAAGGAGATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-1600s1c1
Sequence:CCGGGCTTATCAATGTGGTGGTGATCTCGAGATCACCACCACATTGATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015613.1-688s1c1
Sequence:CCGGCTTGGCCTTCATTGAGACTGACTCGAGTCAGTCTCAATGAAGGCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146245
LRIT1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-1402s1c1
Sequence:CCGGCTCTCAAGGTAGTAGGAGATACTCGAGTATCTCCTACTACCTTGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-754s1c1
Sequence:CCGGGCTGGGTTTCTTCAAACCTGACTCGAGTCAGGTTTGAAGAAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-755s1c1
Sequence:CCGGCTGGGTTTCTTCAAACCTGATCTCGAGATCAGGTTTGAAGAAACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-1505s1c1
Sequence:CCGGGCATCGAGACATGAGAAGGATCTCGAGATCCTTCTCATGTCTCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146245.1-2728s1c1
Sequence:CCGGCCAACCTCTATACTCTTACATCTCGAGATGTAAGAGTATAGAGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146245
LRIT1 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-1402s1c1
Sequence:CCGGCTCTCAAGGTAGTAGGAGATACTCGAGTATCTCCTACTACCTTGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-754s1c1
Sequence:CCGGGCTGGGTTTCTTCAAACCTGACTCGAGTCAGGTTTGAAGAAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-755s1c1
Sequence:CCGGCTGGGTTTCTTCAAACCTGATCTCGAGATCAGGTTTGAAGAAACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-1505s1c1
Sequence:CCGGGCATCGAGACATGAGAAGGATCTCGAGATCCTTCTCATGTCTCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146245.1-2728s1c1
Sequence:CCGGCCAACCTCTATACTCTTACATCTCGAGATGTAAGAGTATAGAGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146245
LRIT1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-1402s1c1
Sequence:CCGGCTCTCAAGGTAGTAGGAGATACTCGAGTATCTCCTACTACCTTGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-754s1c1
Sequence:CCGGGCTGGGTTTCTTCAAACCTGACTCGAGTCAGGTTTGAAGAAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-755s1c1
Sequence:CCGGCTGGGTTTCTTCAAACCTGATCTCGAGATCAGGTTTGAAGAAACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146245.1-1505s1c1
Sequence:CCGGGCATCGAGACATGAGAAGGATCTCGAGATCCTTCTCATGTCTCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146245.1-2728s1c1
Sequence:CCGGCCAACCTCTATACTCTTACATCTCGAGATGTAAGAGTATAGAGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)