EMAIL THIS PAGE TO A FRIEND

LRIT2

leucine-rich repeat, immunoglobulin-like and transmembrane domains 2

54 Gene Product Result for
Synonyms: LRRC22
UniProtKB ID: A6NDA9
Gene ID:
Mouse(239038) leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Rat(498594) leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Zebrafish(553557) leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
domestic cat(101084484) leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
cow(519820) leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Horse(100065147) leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
dog(489071) leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
chicken(100857146) leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
naked mole-rat(101720181) leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Domestic Rabbit(100338185) leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
domestic guinea pig(100725455) leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017924 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022321 MISSION® esiRNA esiRNA targeting mouse Lrit2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017924 Rosetta Predictions human pricing
XM_001065544 Rosetta Predictions rat pricing
XM_573871 Rosetta Predictions rat pricing
NM_173418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168690 predicted 735
2 SASI_Hs01_00168691 predicted 610
3 SASI_Hs01_00168692 predicted 476
4 SASI_Hs01_00168693 predicted 249
5 SASI_Hs01_00168694 predicted 643
6 SASI_Hs01_00168695 predicted 1052
7 SASI_Hs01_00168696 predicted 685
8 SASI_Hs01_00168697 predicted 486
9 SASI_Hs01_00168698 predicted 1360
10 SASI_Hs01_00168699 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314546 predicted 497
2 SASI_Rn02_00314547 predicted 620
3 SASI_Rn02_00314548 predicted 483
4 SASI_Rn02_00314549 predicted 766
5 SASI_Rn02_00314550 predicted 1027
6 SASI_Rn02_00314551 predicted 240
7 SASI_Rn02_00314552 predicted 865
8 SASI_Rn02_00314553 predicted 794
9 SASI_Rn02_00314554 predicted 651
10 SASI_Rn02_00314555 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400953 predicted 497
2 SASI_Rn02_00400954 predicted 624
3 SASI_Rn02_00400955 predicted 478
4 SASI_Rn02_00400956 predicted 762
5 SASI_Rn02_00400957 predicted 1028
6 SASI_Rn02_00400958 predicted 244
7 SASI_Rn02_00400959 predicted 863
8 SASI_Rn02_00400960 predicted 797
9 SASI_Rn02_00400961 predicted 648
10 SASI_Rn02_00400962 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345285 predicted 979
2 SASI_Mm02_00345286 predicted 1480
3 SASI_Mm02_00345287 predicted 1736
4 SASI_Mm02_00345288 predicted 1192
5 SASI_Mm02_00345289 predicted 475
6 SASI_Mm02_00345290 predicted 1218
7 SASI_Mm02_00345291 predicted 1689
8 SASI_Mm02_00345292 predicted 246
9 SASI_Mm02_00345293 predicted 1660
10 SASI_Mm02_00345294 predicted 655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017924
LRIT2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017924.1-488s1c1
Sequence:CCGGCCAATAGGCTTACAGTTGTATCTCGAGATACAACTGTAAGCCTATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017924.1-2154s1c1
Sequence:CCGGCGTTTCCTTGAATGCCTGTTTCTCGAGAAACAGGCATTCAAGGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017924.1-222s1c1
Sequence:CCGGCCAAGGGTCTTTCATCAACATCTCGAGATGTTGATGAAAGACCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017924.1-1561s1c1
Sequence:CCGGGATGGCTCCTTTAGAGAACATCTCGAGATGTTCTCTAAAGGAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017924.1-402s1c1
Sequence:CCGGCTTGGATCTCAAACGCAACAACTCGAGTTGTTGCGTTTGAGATCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017924.1-1246s1c1
Sequence:CCGGCCCGGAATCAATACTTATGCTCTCGAGAGCATAAGTATTGATTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017924.1-2022s1c1
Sequence:CCGGCCTGTAAACGAAGGTAGACTTCTCGAGAAGTCTACCTTCGTTTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017924.1-3023s1c1
Sequence:CCGGCGCTCATTTCTTCAGATTCTACTCGAGTAGAATCTGAAGAAATGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017924.1-162s1c1
Sequence:CCGGGAACCTTTCTGAAGAGTTCAACTCGAGTTGAACTCTTCAGAAAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017924
LRIT2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017924.1-488s1c1
Sequence:CCGGCCAATAGGCTTACAGTTGTATCTCGAGATACAACTGTAAGCCTATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017924.1-2154s1c1
Sequence:CCGGCGTTTCCTTGAATGCCTGTTTCTCGAGAAACAGGCATTCAAGGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017924.1-222s1c1
Sequence:CCGGCCAAGGGTCTTTCATCAACATCTCGAGATGTTGATGAAAGACCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017924.1-1561s1c1
Sequence:CCGGGATGGCTCCTTTAGAGAACATCTCGAGATGTTCTCTAAAGGAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017924.1-402s1c1
Sequence:CCGGCTTGGATCTCAAACGCAACAACTCGAGTTGTTGCGTTTGAGATCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017924.1-1246s1c1
Sequence:CCGGCCCGGAATCAATACTTATGCTCTCGAGAGCATAAGTATTGATTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017924.1-2022s1c1
Sequence:CCGGCCTGTAAACGAAGGTAGACTTCTCGAGAAGTCTACCTTCGTTTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017924.1-3023s1c1
Sequence:CCGGCGCTCATTTCTTCAGATTCTACTCGAGTAGAATCTGAAGAAATGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017924.1-162s1c1
Sequence:CCGGGAACCTTTCTGAAGAGTTCAACTCGAGTTGAACTCTTCAGAAAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017924
LRIT2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017924.1-488s1c1
Sequence:CCGGCCAATAGGCTTACAGTTGTATCTCGAGATACAACTGTAAGCCTATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017924.1-2154s1c1
Sequence:CCGGCGTTTCCTTGAATGCCTGTTTCTCGAGAAACAGGCATTCAAGGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017924.1-222s1c1
Sequence:CCGGCCAAGGGTCTTTCATCAACATCTCGAGATGTTGATGAAAGACCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017924.1-1561s1c1
Sequence:CCGGGATGGCTCCTTTAGAGAACATCTCGAGATGTTCTCTAAAGGAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017924.1-402s1c1
Sequence:CCGGCTTGGATCTCAAACGCAACAACTCGAGTTGTTGCGTTTGAGATCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017924.1-1246s1c1
Sequence:CCGGCCCGGAATCAATACTTATGCTCTCGAGAGCATAAGTATTGATTCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017924.1-2022s1c1
Sequence:CCGGCCTGTAAACGAAGGTAGACTTCTCGAGAAGTCTACCTTCGTTTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017924.1-3023s1c1
Sequence:CCGGCGCTCATTTCTTCAGATTCTACTCGAGTAGAATCTGAAGAAATGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017924.1-162s1c1
Sequence:CCGGGAACCTTTCTGAAGAGTTCAACTCGAGTTGAACTCTTCAGAAAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173418
LRIT2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173418.1-424s1c1
Sequence:CCGGGATCTCAAACACAACCGGATTCTCGAGAATCCGGTTGTGTTTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173418.1-772s1c1
Sequence:CCGGGTTTGTATGAAGCCAACTATTCTCGAGAATAGTTGGCTTCATACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173418.1-871s1c1
Sequence:CCGGCCAACCATTGCATGGAAGTATCTCGAGATACTTCCATGCAATGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173418.1-2234s1c1
Sequence:CCGGCCTTCATTACTTTGGGTTCTTCTCGAGAAGAACCCAAAGTAATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173418.1-1885s1c1
Sequence:CCGGCCTATTAAACTATGCCTGATACTCGAGTATCAGGCATAGTTTAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173418
LRIT2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173418.1-424s1c1
Sequence:CCGGGATCTCAAACACAACCGGATTCTCGAGAATCCGGTTGTGTTTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173418.1-772s1c1
Sequence:CCGGGTTTGTATGAAGCCAACTATTCTCGAGAATAGTTGGCTTCATACAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173418.1-871s1c1
Sequence:CCGGCCAACCATTGCATGGAAGTATCTCGAGATACTTCCATGCAATGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173418.1-2234s1c1
Sequence:CCGGCCTTCATTACTTTGGGTTCTTCTCGAGAAGAACCCAAAGTAATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173418.1-1885s1c1
Sequence:CCGGCCTATTAAACTATGCCTGATACTCGAGTATCAGGCATAGTTTAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173418
LRIT2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173418.1-424s1c1
Sequence:CCGGGATCTCAAACACAACCGGATTCTCGAGAATCCGGTTGTGTTTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173418.1-772s1c1
Sequence:CCGGGTTTGTATGAAGCCAACTATTCTCGAGAATAGTTGGCTTCATACAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173418.1-871s1c1
Sequence:CCGGCCAACCATTGCATGGAAGTATCTCGAGATACTTCCATGCAATGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193357    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173418.1-2234s1c1
Sequence:CCGGCCTTCATTACTTTGGGTTCTTCTCGAGAAGAACCCAAAGTAATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173418.1-1885s1c1
Sequence:CCGGCCTATTAAACTATGCCTGATACTCGAGTATCAGGCATAGTTTAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)