EMAIL THIS PAGE TO A FRIEND

LRIT3

leucine-rich repeat, immunoglobulin-like and transmembrane domains 3

65 Gene Product Result for
Synonyms: CSNB1F FIGLER4
UniProtKB ID: Q3SXY7, C9J1C2, Q6ZTG1
Gene ID:
Human(345193) Summary: This gene encodes a protein that has a fibronectin type III domain and a C-terminal transmembrane domain, as well as a leucine-rich repeat domain and immunoglobulin-like domain near the N-terminus. The encoded protein may regulate fibroblast growth factor receptors and affect the modification of these receptors, which are glycosylated differently in the Golgi and endoplasmic reticulum. Mutations in this gene are associated with congenital stationary night blindness, type 1F. [provided by RefSeq, May 2013]
Mouse(242235) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
Rat(502596) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
sheep(101118529) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
domestic guinea pig(100718104) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
Domestic Rabbit(100357507) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
naked mole-rat(101705760) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
Zebrafish(100144406) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
cow(511618) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
Horse(100072841) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
domestic cat(101083079) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
dog(610534) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
chicken(422696) leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198506 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056511 MISSION® esiRNA esiRNA human LRIT3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198506 Rosetta Predictions human pricing
XM_001076757 Rosetta Predictions rat pricing
XM_578083 Rosetta Predictions rat pricing
XM_143529 Rosetta Predictions mouse pricing
XM_914534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188411 predicted 1988
2 SASI_Hs01_00188412 predicted 2037
3 SASI_Hs01_00188413 predicted 1843
4 SASI_Hs01_00188415 predicted 1055
5 SASI_Hs01_00188416 predicted 2074
6 SASI_Hs01_00188417 predicted 1134
7 SASI_Hs01_00188418 predicted 1815
8 SASI_Hs01_00188419 predicted 1972
9 SASI_Hs01_00188420 predicted 1086
10 SASI_Hs02_00372076 predicted 1852
11 SASI_Hs01_00188414 predicted 1984
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354426 predicted 965
2 SASI_Rn02_00354427 predicted 615
3 SASI_Rn02_00354428 predicted 920
4 SASI_Rn02_00354429 predicted 1184
5 SASI_Rn02_00354430 predicted 476
6 SASI_Rn02_00354431 predicted 387
7 SASI_Rn02_00354432 predicted 1010
8 SASI_Rn02_00354433 predicted 1883
9 SASI_Rn02_00354434 predicted 505
10 SASI_Rn02_00354435 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407549 predicted 754
2 SASI_Rn02_00407550 predicted 858
3 SASI_Rn02_00407551 predicted 1181
4 SASI_Rn02_00407552 predicted 1082
5 SASI_Rn02_00407553 predicted 1289
6 SASI_Rn02_00407554 predicted 653
7 SASI_Rn02_00407555 predicted 1252
8 SASI_Rn02_00407556 predicted 1246
9 SASI_Rn02_00407557 predicted 1130
10 SASI_Rn02_00407558 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_143529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238137 predicted 324
2 SASI_Mm01_00238138 predicted 431
3 SASI_Mm01_00238139 predicted 659
4 SASI_Mm01_00238140 predicted 571
5 SASI_Mm01_00238141 predicted 512
6 SASI_Mm01_00238143 predicted 283
7 SASI_Mm01_00238144 predicted 353
8 SASI_Mm01_00238145 predicted 623
9 SASI_Mm01_00238146 predicted 331
10 SASI_Mm02_00425193 predicted 327
11 SASI_Mm01_00238142 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438624 predicted 709
2 SASI_Mm02_00438625 predicted 1764
3 SASI_Mm02_00438626 predicted 431
4 SASI_Mm02_00438627 predicted 873
5 SASI_Mm02_00438628 predicted 576
6 SASI_Mm02_00438629 predicted 398
7 SASI_Mm02_00438630 predicted 507
8 SASI_Mm02_00438631 predicted 278
9 SASI_Mm02_00438632 predicted 401
10 SASI_Mm02_00438633 predicted 1600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198506
LRIT3 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198506.2-2533s21c1
Sequence:CCGGATGGAGAGCGTGGGATCATAACTCGAGTTATGATCCCACGCTCTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198506.2-1926s21c1
Sequence:CCGGAGGAGACTTATATCCAATTTGCTCGAGCAAATTGGATATAAGTCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198506.2-976s21c1
Sequence:CCGGAGGAGTCAGATGGTCCATAATCTCGAGATTATGGACCATCTGACTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198506.1-2940s1c1
Sequence:CCGGGCTGACAGATTATATGGATATCTCGAGATATCCATATAATCTGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-2080s1c1
Sequence:CCGGCAAAGGAGACTTATATCCAATCTCGAGATTGGATATAAGTCTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198506.2-2132s21c1
Sequence:CCGGACTAGCATCTAAGGGTATAATCTCGAGATTATACCCTTAGATGCTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198506.2-2560s21c1
Sequence:CCGGTTGTGTTCACTAAGGTTAAATCTCGAGATTTAACCTTAGTGAACACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198506.1-2623s1c1
Sequence:CCGGGCCTTGATGTTTATTCATGTTCTCGAGAACATGAATAAACATCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-1342s1c1
Sequence:CCGGCTACATCTGTATCTAGCGCATCTCGAGATGCGCTAGATACAGATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198506.1-3514s1c1
Sequence:CCGGGCACAGATGCAACTTTCATAACTCGAGTTATGAAAGTTGCATCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-2230s1c1
Sequence:CCGGGTTCCAGACCAGAGTATTATTCTCGAGAATAATACTCTGGTCTGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-1093s1c1
Sequence:CCGGCGCCAGTTAATTATACAGTAACTCGAGTTACTGTATAATTAACTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198506
LRIT3 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198506.2-2533s21c1
Sequence:CCGGATGGAGAGCGTGGGATCATAACTCGAGTTATGATCCCACGCTCTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198506.2-1926s21c1
Sequence:CCGGAGGAGACTTATATCCAATTTGCTCGAGCAAATTGGATATAAGTCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198506.2-976s21c1
Sequence:CCGGAGGAGTCAGATGGTCCATAATCTCGAGATTATGGACCATCTGACTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198506.1-2940s1c1
Sequence:CCGGGCTGACAGATTATATGGATATCTCGAGATATCCATATAATCTGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-2080s1c1
Sequence:CCGGCAAAGGAGACTTATATCCAATCTCGAGATTGGATATAAGTCTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198506.2-2132s21c1
Sequence:CCGGACTAGCATCTAAGGGTATAATCTCGAGATTATACCCTTAGATGCTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198506.2-2560s21c1
Sequence:CCGGTTGTGTTCACTAAGGTTAAATCTCGAGATTTAACCTTAGTGAACACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198506.1-2623s1c1
Sequence:CCGGGCCTTGATGTTTATTCATGTTCTCGAGAACATGAATAAACATCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-1342s1c1
Sequence:CCGGCTACATCTGTATCTAGCGCATCTCGAGATGCGCTAGATACAGATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198506.1-3514s1c1
Sequence:CCGGGCACAGATGCAACTTTCATAACTCGAGTTATGAAAGTTGCATCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-2230s1c1
Sequence:CCGGGTTCCAGACCAGAGTATTATTCTCGAGAATAATACTCTGGTCTGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-1093s1c1
Sequence:CCGGCGCCAGTTAATTATACAGTAACTCGAGTTACTGTATAATTAACTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198506
LRIT3 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat, immunoglobulin-like and transmembrane domains 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198506.2-2533s21c1
Sequence:CCGGATGGAGAGCGTGGGATCATAACTCGAGTTATGATCCCACGCTCTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198506.2-1926s21c1
Sequence:CCGGAGGAGACTTATATCCAATTTGCTCGAGCAAATTGGATATAAGTCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198506.2-976s21c1
Sequence:CCGGAGGAGTCAGATGGTCCATAATCTCGAGATTATGGACCATCTGACTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198506.1-2940s1c1
Sequence:CCGGGCTGACAGATTATATGGATATCTCGAGATATCCATATAATCTGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-2080s1c1
Sequence:CCGGCAAAGGAGACTTATATCCAATCTCGAGATTGGATATAAGTCTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198506.2-2132s21c1
Sequence:CCGGACTAGCATCTAAGGGTATAATCTCGAGATTATACCCTTAGATGCTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198506.2-2560s21c1
Sequence:CCGGTTGTGTTCACTAAGGTTAAATCTCGAGATTTAACCTTAGTGAACACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198506.1-2623s1c1
Sequence:CCGGGCCTTGATGTTTATTCATGTTCTCGAGAACATGAATAAACATCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-1342s1c1
Sequence:CCGGCTACATCTGTATCTAGCGCATCTCGAGATGCGCTAGATACAGATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198506.1-3514s1c1
Sequence:CCGGGCACAGATGCAACTTTCATAACTCGAGTTATGAAAGTTGCATCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-2230s1c1
Sequence:CCGGGTTCCAGACCAGAGTATTATTCTCGAGAATAATACTCTGGTCTGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198506.1-1093s1c1
Sequence:CCGGCGCCAGTTAATTATACAGTAACTCGAGTTACTGTATAATTAACTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)