EMAIL THIS PAGE TO A FRIEND

LRMP

lymphoid-restricted membrane protein

124 Gene Product Result for
Synonyms: JAW1
UniProtKB ID: Q12912, A0AVM2, B4E077, Q8N301
Gene ID:
Human(4033) Summary: The protein encode dby this gene is expressed in a developmentally regulated manner in lymphoid cell lines and tissues. The protein is localized to the cytoplasmic face of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Mouse(16970) lymphoid-restricted membrane protein
Rat(500361) lymphoid-restricted membrane protein
Zebrafish(567234) lymphoid-restricted membrane protein
cow(100140494) lymphoid-restricted membrane protein
Horse(100068768) lymphoid-restricted membrane protein
dog(486631) lymphoid-restricted membrane protein
chicken(418205) lymphoid-restricted membrane protein
domestic guinea pig(100722443) lymphoid-restricted membrane protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006152 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006152 Rosetta Predictions human pricing
XM_001074768 Rosetta Predictions rat pricing
XM_575718 Rosetta Predictions rat pricing
NM_008511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216444 predicted 1230
2 SASI_Hs01_00216445 predicted 1100
3 SASI_Hs01_00216446 predicted 2575
4 SASI_Hs01_00216447 predicted 2262
5 SASI_Hs01_00216448 predicted 1517
6 SASI_Hs01_00216449 predicted 2115
7 SASI_Hs01_00216450 predicted 2046
8 SASI_Hs01_00216451 predicted 1461
9 SASI_Hs01_00216452 predicted 1275
10 SASI_Hs02_00340987 predicted 1701
11 SASI_Hs01_00216443 predicted 1758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347302 predicted 1039
2 SASI_Rn02_00347303 predicted 1061
3 SASI_Rn02_00347304 predicted 1538
4 SASI_Rn02_00347305 predicted 977
5 SASI_Rn02_00347306 predicted 993
6 SASI_Rn02_00347307 predicted 1465
7 SASI_Rn02_00347308 predicted 659
8 SASI_Rn02_00347309 predicted 707
9 SASI_Rn02_00347310 predicted 684
10 SASI_Rn02_00347311 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404163 predicted 1024
2 SASI_Rn02_00404164 predicted 1035
3 SASI_Rn02_00404165 predicted 1515
4 SASI_Rn02_00404166 predicted 961
5 SASI_Rn02_00404167 predicted 968
6 SASI_Rn02_00404168 predicted 1445
7 SASI_Rn02_00404169 predicted 662
8 SASI_Rn02_00404170 predicted 699
9 SASI_Rn02_00404171 predicted 692
10 SASI_Rn02_00404172 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048163 predicted 1053
2 SASI_Mm01_00048164 predicted 1034
3 SASI_Mm01_00048165 predicted 972
4 SASI_Mm01_00048166 predicted 665
5 SASI_Mm01_00048167 predicted 1522
6 SASI_Mm01_00048168 predicted 962
7 SASI_Mm01_00048169 predicted 1448
8 SASI_Mm01_00048171 predicted 645
9 SASI_Mm02_00314074 predicted 1295
10 SASI_Mm01_00048172 predicted 1131
11 SASI_Mm01_00048170 predicted 1175
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006152
LRMP MISSION shRNA Bacterial Glycerol Stock
lymphoid-restricted membrane protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006152.2-1842s21c1
Sequence:CCGGGCCAAAGAGCACGCTGAATTACTCGAGTAATTCAGCGTGCTCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006152.2-2576s21c1
Sequence:CCGGCAGTATCTGAACTTCGTAAATCTCGAGATTTACGAAGTTCAGATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006152.1-2317s1c1
Sequence:CCGGGCTGGGAAAGTATAGCATGAACTCGAGTTCATGCTATACTTTCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-881s1c1
Sequence:CCGGCCTGGATTAGAAATTCTGAATCTCGAGATTCAGAATTTCTAATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-1073s1c1
Sequence:CCGGCCAGAAACAATAGAAGAACATCTCGAGATGTTCTTCTATTGTTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-1820s1c1
Sequence:CCGGCGTCCCTCATTACCTCGATTTCTCGAGAAATCGAGGTAATGAGGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-1490s1c1
Sequence:CCGGCGGGTTAGTAAAGCAGTTGAACTCGAGTTCAACTGCTTTACTAACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006152
LRMP MISSION shRNA shRNA Plasmid DNA
lymphoid-restricted membrane protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006152.2-1842s21c1
Sequence:CCGGGCCAAAGAGCACGCTGAATTACTCGAGTAATTCAGCGTGCTCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006152.2-2576s21c1
Sequence:CCGGCAGTATCTGAACTTCGTAAATCTCGAGATTTACGAAGTTCAGATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006152.1-2317s1c1
Sequence:CCGGGCTGGGAAAGTATAGCATGAACTCGAGTTCATGCTATACTTTCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-881s1c1
Sequence:CCGGCCTGGATTAGAAATTCTGAATCTCGAGATTCAGAATTTCTAATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-1073s1c1
Sequence:CCGGCCAGAAACAATAGAAGAACATCTCGAGATGTTCTTCTATTGTTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-1820s1c1
Sequence:CCGGCGTCCCTCATTACCTCGATTTCTCGAGAAATCGAGGTAATGAGGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-1490s1c1
Sequence:CCGGCGGGTTAGTAAAGCAGTTGAACTCGAGTTCAACTGCTTTACTAACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006152
LRMP MISSION shRNA Lentiviral Transduction Particles
lymphoid-restricted membrane protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006152.2-1842s21c1
Sequence:CCGGGCCAAAGAGCACGCTGAATTACTCGAGTAATTCAGCGTGCTCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006152.2-2576s21c1
Sequence:CCGGCAGTATCTGAACTTCGTAAATCTCGAGATTTACGAAGTTCAGATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006152.1-2317s1c1
Sequence:CCGGGCTGGGAAAGTATAGCATGAACTCGAGTTCATGCTATACTTTCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-881s1c1
Sequence:CCGGCCTGGATTAGAAATTCTGAATCTCGAGATTCAGAATTTCTAATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-1073s1c1
Sequence:CCGGCCAGAAACAATAGAAGAACATCTCGAGATGTTCTTCTATTGTTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-1820s1c1
Sequence:CCGGCGTCCCTCATTACCTCGATTTCTCGAGAAATCGAGGTAATGAGGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006152.1-1490s1c1
Sequence:CCGGCGGGTTAGTAAAGCAGTTGAACTCGAGTTCAACTGCTTTACTAACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008511
LRMP MISSION shRNA Bacterial Glycerol Stock
lymphoid-restricted membrane protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-492s1c1
Sequence:CCGGGCTTCTAGACTGTACCAGAATCTCGAGATTCTGGTACAGTCTAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-978s1c1
Sequence:CCGGCAGGTTATCTTTGGGACTTAACTCGAGTTAAGTCCCAAAGATAACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-976s1c1
Sequence:CCGGCTCAGGTTATCTTTGGGACTTCTCGAGAAGTCCCAAAGATAACCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-1591s1c1
Sequence:CCGGCATCGCTTCATCAGCACCTATCTCGAGATAGGTGCTGATGAAGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008511.2-2036s1c1
Sequence:CCGGCGTTTCCTTCTGAGATTTGTACTCGAGTACAAATCTCAGAAGGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008511
LRMP MISSION shRNA shRNA Plasmid DNA
lymphoid-restricted membrane protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-492s1c1
Sequence:CCGGGCTTCTAGACTGTACCAGAATCTCGAGATTCTGGTACAGTCTAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-978s1c1
Sequence:CCGGCAGGTTATCTTTGGGACTTAACTCGAGTTAAGTCCCAAAGATAACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-976s1c1
Sequence:CCGGCTCAGGTTATCTTTGGGACTTCTCGAGAAGTCCCAAAGATAACCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-1591s1c1
Sequence:CCGGCATCGCTTCATCAGCACCTATCTCGAGATAGGTGCTGATGAAGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008511.2-2036s1c1
Sequence:CCGGCGTTTCCTTCTGAGATTTGTACTCGAGTACAAATCTCAGAAGGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008511
LRMP MISSION shRNA Lentiviral Transduction Particles
lymphoid-restricted membrane protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-492s1c1
Sequence:CCGGGCTTCTAGACTGTACCAGAATCTCGAGATTCTGGTACAGTCTAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-978s1c1
Sequence:CCGGCAGGTTATCTTTGGGACTTAACTCGAGTTAAGTCCCAAAGATAACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-976s1c1
Sequence:CCGGCTCAGGTTATCTTTGGGACTTCTCGAGAAGTCCCAAAGATAACCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008511.2-1591s1c1
Sequence:CCGGCATCGCTTCATCAGCACCTATCTCGAGATAGGTGCTGATGAAGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008511.2-2036s1c1
Sequence:CCGGCGTTTCCTTCTGAGATTTGTACTCGAGTACAAATCTCAGAAGGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)