EMAIL THIS PAGE TO A FRIEND

LRP10

low density lipoprotein receptor-related protein 10

60 Gene Product Result for
Synonyms: LRP9 MST087
Gene ID:
Mouse(65107) low-density lipoprotein receptor-related protein 10
Rat(305880) low-density lipoprotein receptor-related protein 10
domestic cat(101090021) low density lipoprotein receptor-related protein 10
Horse(100052839) low density lipoprotein receptor-related protein 10
cow(515494) low density lipoprotein receptor-related protein 10
dog(608002) low density lipoprotein receptor-related protein 10
naked mole-rat(101723435) low density lipoprotein receptor-related protein 10
domestic guinea pig(100731766) low density lipoprotein receptor-related protein 10
sheep(101104404) low density lipoprotein receptor-related protein 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014045 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014045 Rosetta Predictions human pricing
NM_001037777 Rosetta Predictions rat pricing
NM_022993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068047 predicted 2091
2 SASI_Hs01_00068048 predicted 2087
3 SASI_Hs01_00068050 predicted 2139
4 SASI_Hs01_00068051 predicted 2739
5 SASI_Hs01_00068052 predicted 1411
6 SASI_Hs01_00068053 predicted 2082
7 SASI_Hs01_00068054 predicted 1461
8 SASI_Hs01_00068055 predicted 2026
9 SASI_Hs01_00068056 predicted 1120
10 SASI_Hs02_00345042 predicted 1431
11 SASI_Hs01_00068049 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054201 predicted 568
2 SASI_Rn01_00054203 predicted 1995
3 SASI_Rn01_00054204 predicted 1960
4 SASI_Rn01_00054205 predicted 2531
5 SASI_Rn01_00054206 predicted 595
6 SASI_Rn01_00054207 predicted 1873
7 SASI_Rn01_00054208 predicted 961
8 SASI_Rn02_00204572 predicted 1251
9 SASI_Rn01_00054209 predicted 1893
10 SASI_Rn01_00054210 predicted 497
11 SASI_Rn01_00054202 predicted 2460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133551 predicted 1877
2 SASI_Mm01_00133553 predicted 1960
3 SASI_Mm01_00133554 predicted 626
4 SASI_Mm01_00133555 predicted 2572
5 SASI_Mm01_00133556 predicted 2024
6 SASI_Mm01_00133558 predicted 1903
7 SASI_Mm01_00133559 predicted 2301
8 SASI_Mm02_00326715 predicted 1412
9 SASI_Mm02_00326716 predicted 2014
10 SASI_Mm01_00133560 predicted 1350
11 SASI_Mm01_00133552 predicted 1978
12 SASI_Mm01_00133557 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014045
LRP10 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014045.3-2140s21c1
Sequence:CCGGACAGATCTTACGCCAGGATATCTCGAGATATCCTGGCGTAAGATCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014045.3-1284s21c1
Sequence:CCGGGAGATGCAGTGCATGTGTATGCTCGAGCATACACATGCACTGCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014045.2-2654s1c1
Sequence:CCGGGCTCTACTCATAGTGGCACAACTCGAGTTGTGCCACTATGAGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-1998s1c1
Sequence:CCGGGAAGACTTTCCTACAGAGAATCTCGAGATTCTCTGTAGGAAAGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-1610s1c1
Sequence:CCGGCCGCTGCAACTACCAGACTTTCTCGAGAAAGTCTGGTAGTTGCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-520s1c1
Sequence:CCGGCCCATCCAGACCGGATTATTTCTCGAGAAATAATCCGGTCTGGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-2414s1c1
Sequence:CCGGGCCATCACTATTGTCTGGAGTCTCGAGACTCCAGACAATAGTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014045
LRP10 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014045.3-2140s21c1
Sequence:CCGGACAGATCTTACGCCAGGATATCTCGAGATATCCTGGCGTAAGATCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014045.3-1284s21c1
Sequence:CCGGGAGATGCAGTGCATGTGTATGCTCGAGCATACACATGCACTGCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014045.2-2654s1c1
Sequence:CCGGGCTCTACTCATAGTGGCACAACTCGAGTTGTGCCACTATGAGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-1998s1c1
Sequence:CCGGGAAGACTTTCCTACAGAGAATCTCGAGATTCTCTGTAGGAAAGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-1610s1c1
Sequence:CCGGCCGCTGCAACTACCAGACTTTCTCGAGAAAGTCTGGTAGTTGCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-520s1c1
Sequence:CCGGCCCATCCAGACCGGATTATTTCTCGAGAAATAATCCGGTCTGGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-2414s1c1
Sequence:CCGGGCCATCACTATTGTCTGGAGTCTCGAGACTCCAGACAATAGTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014045
LRP10 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014045.3-2140s21c1
Sequence:CCGGACAGATCTTACGCCAGGATATCTCGAGATATCCTGGCGTAAGATCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014045.3-1284s21c1
Sequence:CCGGGAGATGCAGTGCATGTGTATGCTCGAGCATACACATGCACTGCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014045.2-2654s1c1
Sequence:CCGGGCTCTACTCATAGTGGCACAACTCGAGTTGTGCCACTATGAGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-1998s1c1
Sequence:CCGGGAAGACTTTCCTACAGAGAATCTCGAGATTCTCTGTAGGAAAGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-1610s1c1
Sequence:CCGGCCGCTGCAACTACCAGACTTTCTCGAGAAAGTCTGGTAGTTGCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-520s1c1
Sequence:CCGGCCCATCCAGACCGGATTATTTCTCGAGAAATAATCCGGTCTGGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014045.2-2414s1c1
Sequence:CCGGGCCATCACTATTGTCTGGAGTCTCGAGACTCCAGACAATAGTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022993
LRP10 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022993.3-759s21c1
Sequence:CCGGGGCAATGTCACCATTACATACCTCGAGGTATGTAATGGTGACATTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022993.3-2490s21c1
Sequence:CCGGGAGGACGATGTATTGTTATTGCTCGAGCAATAACAATACATCGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022993.3-2773s21c1
Sequence:CCGGGCTTGGACACTCCGTTCTTTCCTCGAGGAAAGAACGGAGTGTCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022993.3-2621s1c1
Sequence:CCGGCTGATCTATGTAGCACAGAAACTCGAGTTTCTGTGCTACATAGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-1650s1c1
Sequence:CCGGCGGGATGAGAAGTGTGTGTATCTCGAGATACACACACTTCTCATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-2544s1c1
Sequence:CCGGGCAGAGGATGAACCATTGCTTCTCGAGAAGCAATGGTTCATCCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-2122s1c1
Sequence:CCGGGCCTGCTTCCTCGAACTAATACTCGAGTATTAGTTCGAGGAAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-619s1c1
Sequence:CCGGGCAGCAAGGATCAGACAGTAACTCGAGTTACTGTCTGATCCTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022993
LRP10 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022993.3-759s21c1
Sequence:CCGGGGCAATGTCACCATTACATACCTCGAGGTATGTAATGGTGACATTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022993.3-2490s21c1
Sequence:CCGGGAGGACGATGTATTGTTATTGCTCGAGCAATAACAATACATCGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022993.3-2773s21c1
Sequence:CCGGGCTTGGACACTCCGTTCTTTCCTCGAGGAAAGAACGGAGTGTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022993.3-2621s1c1
Sequence:CCGGCTGATCTATGTAGCACAGAAACTCGAGTTTCTGTGCTACATAGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-1650s1c1
Sequence:CCGGCGGGATGAGAAGTGTGTGTATCTCGAGATACACACACTTCTCATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-2544s1c1
Sequence:CCGGGCAGAGGATGAACCATTGCTTCTCGAGAAGCAATGGTTCATCCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-2122s1c1
Sequence:CCGGGCCTGCTTCCTCGAACTAATACTCGAGTATTAGTTCGAGGAAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-619s1c1
Sequence:CCGGGCAGCAAGGATCAGACAGTAACTCGAGTTACTGTCTGATCCTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022993
LRP10 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022993.3-759s21c1
Sequence:CCGGGGCAATGTCACCATTACATACCTCGAGGTATGTAATGGTGACATTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022993.3-2490s21c1
Sequence:CCGGGAGGACGATGTATTGTTATTGCTCGAGCAATAACAATACATCGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022993.3-2773s21c1
Sequence:CCGGGCTTGGACACTCCGTTCTTTCCTCGAGGAAAGAACGGAGTGTCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022993.3-2621s1c1
Sequence:CCGGCTGATCTATGTAGCACAGAAACTCGAGTTTCTGTGCTACATAGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-1650s1c1
Sequence:CCGGCGGGATGAGAAGTGTGTGTATCTCGAGATACACACACTTCTCATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-2544s1c1
Sequence:CCGGGCAGAGGATGAACCATTGCTTCTCGAGAAGCAATGGTTCATCCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-2122s1c1
Sequence:CCGGGCCTGCTTCCTCGAACTAATACTCGAGTATTAGTTCGAGGAAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022993.3-619s1c1
Sequence:CCGGGCAGCAAGGATCAGACAGTAACTCGAGTTACTGTCTGATCCTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)