EMAIL THIS PAGE TO A FRIEND

LRP11

low density lipoprotein receptor-related protein 11

53 Gene Product Result for
Synonyms: MANSC3 bA350J20.3
UniProtKB ID: Q86VZ4, Q5VYC0, Q96SN6
Gene ID:
Mouse(237253) low density lipoprotein receptor-related protein 11
Rat(292462) low density lipoprotein receptor-related protein 11
sheep(101104759) low density lipoprotein receptor-related protein 11
domestic guinea pig(100716242) low density lipoprotein receptor-related protein 11
naked mole-rat(101719530) low density lipoprotein receptor-related protein 11
Zebrafish(569216) low density lipoprotein receptor-related protein 11
chicken(421629) low density lipoprotein receptor-related protein 11
cow(617450) low density lipoprotein receptor-related protein 11
dog(100688818) low density lipoprotein receptor-related protein 11
domestic cat(101081983) low density lipoprotein receptor-related protein 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032832 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032832 Rosetta Predictions human pricing
NM_001106217 Rosetta Predictions rat pricing
NM_172784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049434 predicted 2105
2 SASI_Hs01_00049435 predicted 2116
3 SASI_Hs01_00049436 predicted 2122
4 SASI_Hs01_00049437 predicted 2078
5 SASI_Hs01_00049439 predicted 2015
6 SASI_Hs01_00049440 predicted 1800
7 SASI_Hs01_00049441 predicted 1335
8 SASI_Hs01_00049442 predicted 1547
9 SASI_Hs01_00049443 predicted 1769
10 SASI_Hs02_00360425 predicted 1478
11 SASI_Hs01_00049438 predicted 1885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216788 predicted 1624
2 SASI_Rn02_00216789 predicted 1627
3 SASI_Rn02_00216790 predicted 1675
4 SASI_Rn02_00216791 predicted 1302
5 SASI_Rn02_00216792 predicted 1685
6 SASI_Rn02_00216793 predicted 1387
7 SASI_Rn02_00216794 predicted 1741
8 SASI_Rn02_00216795 predicted 1315
9 SASI_Rn02_00216796 predicted 1431
10 SASI_Rn02_00216797 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034068 predicted 1165
2 SASI_Mm01_00034069 predicted 1959
3 SASI_Mm02_00344680 predicted 1718
4 SASI_Mm01_00034070 predicted 998
5 SASI_Mm01_00034072 predicted 1197
6 SASI_Mm01_00034073 predicted 1461
7 SASI_Mm01_00034074 predicted 1148
8 SASI_Mm01_00034076 predicted 1457
9 SASI_Mm01_00034077 predicted 1857
10 SASI_Mm02_00344681 predicted 1703
11 SASI_Mm01_00034071 predicted 1683
12 SASI_Mm01_00034075 predicted 1742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032832
VALIDATED
LRP11 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1343s1c1
Sequence:CCGGGATGAAGACTTCTGCCAGAATCTCGAGATTCTGGCAGAAGTCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1552s1c1
Sequence:CCGGGAGTCAAATCATTCCTGTGATCTCGAGATCACAGGAATGATTTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1793s1c1
Sequence:CCGGGAATCGGACTACCTCATAAATCTCGAGATTTATGAGGTAGTCCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-796s1c1
Sequence:CCGGGCTCGGCTGCTACCTCTTCAACTCGAGTTGAAGAGGTAGCAGCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1233s1c1
Sequence:CCGGCAGGAGGATGTTTGCACACTTCTCGAGAAGTGTGCAAACATCCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032832.5-1086s21c1
Sequence:CCGGGGACATGAAGGTGCCTCAATCCTCGAGGATTGAGGCACCTTCATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032832.5-2135s21c1
Sequence:CCGGGATGACTGTGTTAACCCATTACTCGAGTAATGGGTTAACACAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032832.5-1933s21c1
Sequence:CCGGAGATTCTGCAAATCCCAAATCCTCGAGGATTTGGGATTTGCAGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032832.5-1487s21c1
Sequence:CCGGCAAACAAGCCACCTGCATTATCTCGAGATAATGCAGGTGGCTTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032832
VALIDATED
LRP11 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1343s1c1
Sequence:CCGGGATGAAGACTTCTGCCAGAATCTCGAGATTCTGGCAGAAGTCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1552s1c1
Sequence:CCGGGAGTCAAATCATTCCTGTGATCTCGAGATCACAGGAATGATTTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1793s1c1
Sequence:CCGGGAATCGGACTACCTCATAAATCTCGAGATTTATGAGGTAGTCCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-796s1c1
Sequence:CCGGGCTCGGCTGCTACCTCTTCAACTCGAGTTGAAGAGGTAGCAGCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1233s1c1
Sequence:CCGGCAGGAGGATGTTTGCACACTTCTCGAGAAGTGTGCAAACATCCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032832.5-1086s21c1
Sequence:CCGGGGACATGAAGGTGCCTCAATCCTCGAGGATTGAGGCACCTTCATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032832.5-2135s21c1
Sequence:CCGGGATGACTGTGTTAACCCATTACTCGAGTAATGGGTTAACACAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032832.5-1933s21c1
Sequence:CCGGAGATTCTGCAAATCCCAAATCCTCGAGGATTTGGGATTTGCAGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032832.5-1487s21c1
Sequence:CCGGCAAACAAGCCACCTGCATTATCTCGAGATAATGCAGGTGGCTTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032832
VALIDATED
LRP11 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1343s1c1
Sequence:CCGGGATGAAGACTTCTGCCAGAATCTCGAGATTCTGGCAGAAGTCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1552s1c1
Sequence:CCGGGAGTCAAATCATTCCTGTGATCTCGAGATCACAGGAATGATTTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1793s1c1
Sequence:CCGGGAATCGGACTACCTCATAAATCTCGAGATTTATGAGGTAGTCCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-796s1c1
Sequence:CCGGGCTCGGCTGCTACCTCTTCAACTCGAGTTGAAGAGGTAGCAGCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032832.3-1233s1c1
Sequence:CCGGCAGGAGGATGTTTGCACACTTCTCGAGAAGTGTGCAAACATCCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032832.5-1086s21c1
Sequence:CCGGGGACATGAAGGTGCCTCAATCCTCGAGGATTGAGGCACCTTCATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032832.5-2135s21c1
Sequence:CCGGGATGACTGTGTTAACCCATTACTCGAGTAATGGGTTAACACAGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032832.5-1933s21c1
Sequence:CCGGAGATTCTGCAAATCCCAAATCCTCGAGGATTTGGGATTTGCAGAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032832.5-1487s21c1
Sequence:CCGGCAAACAAGCCACCTGCATTATCTCGAGATAATGCAGGTGGCTTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172784
VALIDATED
LRP11 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-3220s1c1
Sequence:CCGGCCCAGTAAATAGAAACTGATACTCGAGTATCAGTTTCTATTTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-1147s1c1
Sequence:CCGGCTGCTGTATTGACATAGCGTTCTCGAGAACGCTATGTCAATACAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-362s1c1
Sequence:CCGGGATAGGCTGCTTCAGGACTTTCTCGAGAAAGTCCTGAAGCAGCCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-1652s1c1
Sequence:CCGGGAATCGGACTACCTCATCAATCTCGAGATTGATGAGGTAGTCCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172784.1-1146s1c1
Sequence:CCGGGCTGCTGTATTGACATAGCGTCTCGAGACGCTATGTCAATACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172784
VALIDATED
LRP11 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-3220s1c1
Sequence:CCGGCCCAGTAAATAGAAACTGATACTCGAGTATCAGTTTCTATTTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-1147s1c1
Sequence:CCGGCTGCTGTATTGACATAGCGTTCTCGAGAACGCTATGTCAATACAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-362s1c1
Sequence:CCGGGATAGGCTGCTTCAGGACTTTCTCGAGAAAGTCCTGAAGCAGCCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-1652s1c1
Sequence:CCGGGAATCGGACTACCTCATCAATCTCGAGATTGATGAGGTAGTCCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172784.1-1146s1c1
Sequence:CCGGGCTGCTGTATTGACATAGCGTCTCGAGACGCTATGTCAATACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172784
VALIDATED
LRP11 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-3220s1c1
Sequence:CCGGCCCAGTAAATAGAAACTGATACTCGAGTATCAGTTTCTATTTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-1147s1c1
Sequence:CCGGCTGCTGTATTGACATAGCGTTCTCGAGAACGCTATGTCAATACAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-362s1c1
Sequence:CCGGGATAGGCTGCTTCAGGACTTTCTCGAGAAAGTCCTGAAGCAGCCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172784.1-1652s1c1
Sequence:CCGGGAATCGGACTACCTCATCAATCTCGAGATTGATGAGGTAGTCCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172784.1-1146s1c1
Sequence:CCGGGCTGCTGTATTGACATAGCGTCTCGAGACGCTATGTCAATACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)