EMAIL THIS PAGE TO A FRIEND

LRP12

low density lipoprotein receptor-related protein 12

165 Gene Product Result for
Synonyms: ST7
UniProtKB ID: Q9Y561, A8K137, B4DRQ2
Gene ID:
Human(29967) Summary: This gene encodes a member of the low-density lipoprotein receptor related protein family. The product of this gene is a transmembrane protein that is differentially expressed in many cancer cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Mouse(239393) low density lipoprotein-related protein 12
Rat(314941) low density lipoprotein receptor-related protein 12
Zebrafish(100034487) low density lipoprotein receptor-related protein 12
chicken(420267) low density lipoprotein receptor-related protein 12
cow(519993) low density lipoprotein receptor-related protein 12
Horse(100062962) low density lipoprotein receptor-related protein 12
domestic cat(101085269) low density lipoprotein receptor-related protein 12
dog(481996) low density lipoprotein receptor-related protein 12
naked mole-rat(101700916) low density lipoprotein receptor-related protein 12
Domestic Rabbit(100340740) low density lipoprotein receptor-related protein 12
domestic guinea pig(100717519) low density lipoprotein receptor-related protein 12
sheep(101123640) low density lipoprotein receptor-related protein 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1723 Human ST7 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013437 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013437 Rosetta Predictions human pricing
NM_001134883 Rosetta Predictions rat pricing
XM_001062208 Rosetta Predictions rat pricing
NM_172814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199977 predicted 942
2 SASI_Hs01_00199978 predicted 492
3 SASI_Hs01_00199979 predicted 452
4 SASI_Hs01_00199980 predicted 2642
5 SASI_Hs01_00199981 predicted 884
6 SASI_Hs01_00199982 predicted 2621
7 SASI_Hs01_00199983 predicted 1174
8 SASI_Hs02_00344838 predicted 1514
9 SASI_Hs01_00199985 predicted 1736
10 SASI_Hs02_00344839 predicted 1555
11 SASI_Hs01_00199976 predicted 2122
12 SASI_Hs01_00199984 predicted 2295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258954 predicted 1993
2 SASI_Rn02_00258955 predicted 2584
3 SASI_Rn02_00258956 predicted 2299
4 SASI_Rn02_00258957 predicted 385
5 SASI_Rn02_00258958 predicted 1180
6 SASI_Rn02_00258959 predicted 1553
7 SASI_Rn02_00258960 predicted 446
8 SASI_Rn02_00258961 predicted 1123
9 SASI_Rn02_00258962 predicted 401
10 SASI_Rn02_00258963 predicted 1750
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302688 predicted 1986
2 SASI_Rn02_00302689 predicted 2583
3 SASI_Rn02_00302690 predicted 2296
4 SASI_Rn02_00302691 predicted 386
5 SASI_Rn02_00302692 predicted 1177
6 SASI_Rn02_00302693 predicted 1559
7 SASI_Rn02_00302694 predicted 445
8 SASI_Rn02_00302695 predicted 1119
9 SASI_Rn02_00302696 predicted 399
10 SASI_Rn02_00302697 predicted 1749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046396 predicted 1848
2 SASI_Mm01_00046397 predicted 1726
3 SASI_Mm01_00046398 predicted 1109
4 SASI_Mm01_00046399 predicted 1870
5 SASI_Mm01_00046400 predicted 2586
6 SASI_Mm01_00046401 predicted 1628
7 SASI_Mm01_00046402 predicted 439
8 SASI_Mm01_00046403 predicted 1168
9 SASI_Mm01_00046404 predicted 1637
10 SASI_Mm02_00344739 predicted 1316
11 SASI_Mm01_00046405 predicted 2422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013437
LRP12 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 12
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013437.3-3089s21c1
Sequence:CCGGACTAGATGTTAAGGTTGTTAACTCGAGTTAACAACCTTAACATCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-467s21c1
Sequence:CCGGCACAATTCCACCTCCGTATATCTCGAGATATACGGAGGTGGAATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013437.3-2800s21c1
Sequence:CCGGATGTTAGCCTGCATGGTTAAACTCGAGTTTAACCATGCAGGCTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-345s21c1
Sequence:CCGGCCAGGCGAAATCATTACTATACTCGAGTATAGTAATGATTTCGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-424s1c1
Sequence:CCGGCCTCCGTATATCTCTTCACAACTCGAGTTGTGAAGAGATATACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-2507s21c1
Sequence:CCGGAGGGCTTAGACAACCATATAACTCGAGTTATATGGTTGTCTAAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-292s1c1
Sequence:CCGGCCAGGCGAAATCATTACTATACTCGAGTATAGTAATGATTTCGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-1828s1c1
Sequence:CCGGGCAGGCAGATCAAGCAACATTCTCGAGAATGTTGCTTGATCTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-1399s1c1
Sequence:CCGGCCAGGAAATTTCCATTGTAAACTCGAGTTTACAATGGAAATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-2485s1c1
Sequence:CCGGCCTGGAGTAAGGCCAAGTAATCTCGAGATTACTTGGCCTTACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-258s21c1
Sequence:CCGGCGAGCACCAAGTGGCATAATCCTCGAGGATTATGCCACTTGGTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013437
LRP12 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 12
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013437.3-3089s21c1
Sequence:CCGGACTAGATGTTAAGGTTGTTAACTCGAGTTAACAACCTTAACATCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-467s21c1
Sequence:CCGGCACAATTCCACCTCCGTATATCTCGAGATATACGGAGGTGGAATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013437.3-2800s21c1
Sequence:CCGGATGTTAGCCTGCATGGTTAAACTCGAGTTTAACCATGCAGGCTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-345s21c1
Sequence:CCGGCCAGGCGAAATCATTACTATACTCGAGTATAGTAATGATTTCGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-424s1c1
Sequence:CCGGCCTCCGTATATCTCTTCACAACTCGAGTTGTGAAGAGATATACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-2507s21c1
Sequence:CCGGAGGGCTTAGACAACCATATAACTCGAGTTATATGGTTGTCTAAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-292s1c1
Sequence:CCGGCCAGGCGAAATCATTACTATACTCGAGTATAGTAATGATTTCGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-1828s1c1
Sequence:CCGGGCAGGCAGATCAAGCAACATTCTCGAGAATGTTGCTTGATCTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-1399s1c1
Sequence:CCGGCCAGGAAATTTCCATTGTAAACTCGAGTTTACAATGGAAATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-2485s1c1
Sequence:CCGGCCTGGAGTAAGGCCAAGTAATCTCGAGATTACTTGGCCTTACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-258s21c1
Sequence:CCGGCGAGCACCAAGTGGCATAATCCTCGAGGATTATGCCACTTGGTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013437
LRP12 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 12
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013437.3-3089s21c1
Sequence:CCGGACTAGATGTTAAGGTTGTTAACTCGAGTTAACAACCTTAACATCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-467s21c1
Sequence:CCGGCACAATTCCACCTCCGTATATCTCGAGATATACGGAGGTGGAATTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013437.3-2800s21c1
Sequence:CCGGATGTTAGCCTGCATGGTTAAACTCGAGTTTAACCATGCAGGCTAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-345s21c1
Sequence:CCGGCCAGGCGAAATCATTACTATACTCGAGTATAGTAATGATTTCGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-424s1c1
Sequence:CCGGCCTCCGTATATCTCTTCACAACTCGAGTTGTGAAGAGATATACGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-2507s21c1
Sequence:CCGGAGGGCTTAGACAACCATATAACTCGAGTTATATGGTTGTCTAAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-292s1c1
Sequence:CCGGCCAGGCGAAATCATTACTATACTCGAGTATAGTAATGATTTCGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-1828s1c1
Sequence:CCGGGCAGGCAGATCAAGCAACATTCTCGAGAATGTTGCTTGATCTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-1399s1c1
Sequence:CCGGCCAGGAAATTTCCATTGTAAACTCGAGTTTACAATGGAAATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013437.2-2485s1c1
Sequence:CCGGCCTGGAGTAAGGCCAAGTAATCTCGAGATTACTTGGCCTTACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013437.3-258s21c1
Sequence:CCGGCGAGCACCAAGTGGCATAATCCTCGAGGATTATGCCACTTGGTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172814
VALIDATED
LRP12 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-1432s1c1
Sequence:CCGGGCCAGGGAATTTCCACTGTAACTCGAGTTACAGTGGAAATTCCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-1117s1c1
Sequence:CCGGCGGACAGATAAGAGTACATTTCTCGAGAAATGTACTCTTATCTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-776s1c1
Sequence:CCGGCCTGAGTCCTTAAAGTGTGATCTCGAGATCACACTTTAAGGACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-3370s1c1
Sequence:CCGGCGGATGAAGATTCTCTACTATCTCGAGATAGTAGAGAATCTTCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-1116s1c1
Sequence:CCGGCCGGACAGATAAGAGTACATTCTCGAGAATGTACTCTTATCTGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172814
VALIDATED
LRP12 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-1432s1c1
Sequence:CCGGGCCAGGGAATTTCCACTGTAACTCGAGTTACAGTGGAAATTCCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-1117s1c1
Sequence:CCGGCGGACAGATAAGAGTACATTTCTCGAGAAATGTACTCTTATCTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-776s1c1
Sequence:CCGGCCTGAGTCCTTAAAGTGTGATCTCGAGATCACACTTTAAGGACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-3370s1c1
Sequence:CCGGCGGATGAAGATTCTCTACTATCTCGAGATAGTAGAGAATCTTCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-1116s1c1
Sequence:CCGGCCGGACAGATAAGAGTACATTCTCGAGAATGTACTCTTATCTGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172814
VALIDATED
LRP12 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-1432s1c1
Sequence:CCGGGCCAGGGAATTTCCACTGTAACTCGAGTTACAGTGGAAATTCCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-1117s1c1
Sequence:CCGGCGGACAGATAAGAGTACATTTCTCGAGAAATGTACTCTTATCTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-776s1c1
Sequence:CCGGCCTGAGTCCTTAAAGTGTGATCTCGAGATCACACTTTAAGGACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-3370s1c1
Sequence:CCGGCGGATGAAGATTCTCTACTATCTCGAGATAGTAGAGAATCTTCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172814.1-1116s1c1
Sequence:CCGGCCGGACAGATAAGAGTACATTCTCGAGAATGTACTCTTATCTGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)