EMAIL THIS PAGE TO A FRIEND

LRP1

low density lipoprotein receptor-related protein 1

69 Gene Product Result for
Synonyms: A2MR APOER APR CD91 IGFBP3R LRP LRP1A TGFBR5
UniProtKB ID: Q07954, Q2PP12, Q8IVG8
Gene ID:
Human(4035) Summary: The protein encoded by this gene is an endocytic receptor involved in several cellular processes, including intracellular signaling, lipid homeostasis, and clearance of apoptotic cells. In addition, the encoded protein is necessary for the A2M-mediated clearance of secreted amyloid precursor protein and beta-amyloid, the main component of amyloid plaques found in Alzheimer patients. Expression of this gene decreases with age and has been found to be lower than controls in brain tissue from Alzheimer patients. [provided by RefSeq, Jan 2010]
Mouse(16971) low density lipoprotein receptor-related protein 1
Rat(299858) low density lipoprotein receptor-related protein 1
sheep(101120656) low density lipoprotein receptor-related protein 1
domestic guinea pig(100726418) low density lipoprotein receptor-related protein 1
naked mole-rat(101723541) low density lipoprotein receptor-related protein 1
Domestic Rabbit(100009571) low density lipoprotein receptor-related protein 1
Domestic Rabbit(100009547) low density lipoprotein receptor-related protein 1
fruit fly(35799) LDL receptor protein 1
cow(533894) low density lipoprotein receptor-related protein 1
domestic cat(101090780) low density lipoprotein receptor-related protein 1
dog(481124) low density lipoprotein receptor-related protein 1
chicken(396170) low density lipoprotein receptor-related protein 1
Thale Cress(831108) lateral root primordium protein-like protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501785 Anti-CD91 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB2101380 Anti-LRP1 (ab1) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2101381 Anti-LRP1 (ab2) antibody produced in rabbit affinity isolated antibody canine, rabbit, bovine, human, mouse
western blot pricing
SAB1300081 Anti-LRP1 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
L2170 Anti-LRP1 (C-terminal) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
immunofluorescence, western blot pricing
L2295 Anti-LRP1 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunofluorescence, western blot pricing
SAB1400154 Anti-LRP1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA022903 Anti-LRP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA004182 Anti-LRP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1305625 ANTI-PHOSPHO-LPR1(S4520) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
L2420 Monoclonal Anti-LRP1 antibody produced in mouse ~1.0 mg/mL, clone LRP1-11, purified immunoglobulin, buffered aqueous solution rat, mouse, human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002332 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067421 MISSION® esiRNA esiRNA human LRP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002332 Rosetta Predictions human pricing
XM_001056970 Rosetta Predictions rat pricing
XM_243524 Rosetta Predictions rat pricing
NM_008512 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104587 predicted 4300
2 SASI_Hs01_00104588 predicted 3408
3 SASI_Hs01_00104589 predicted 4460
4 SASI_Hs01_00104591 predicted 9564
5 SASI_Hs01_00104592 predicted 6680
6 SASI_Hs01_00104593 predicted 4974
7 SASI_Hs01_00104594 predicted 12638
8 SASI_Hs02_00333647 predicted 13479
9 SASI_Hs01_00104595 predicted 2412
10 SASI_Hs01_00104596 predicted 7092
11 SASI_Hs01_00104590 predicted 3600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284970 predicted 4850
2 SASI_Rn02_00284971 predicted 13360
3 SASI_Rn02_00284972 predicted 5395
4 SASI_Rn02_00284973 predicted 10053
5 SASI_Rn02_00284974 predicted 2503
6 SASI_Rn02_00284975 predicted 5375
7 SASI_Rn02_00284976 predicted 682
8 SASI_Rn02_00284977 predicted 8041
9 SASI_Rn02_00284978 predicted 4711
10 SASI_Rn02_00284979 predicted 6811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_243524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391739 predicted 4976
2 SASI_Rn02_00391740 predicted 13487
3 SASI_Rn02_00391741 predicted 5512
4 SASI_Rn02_00391742 predicted 10179
5 SASI_Rn02_00391743 predicted 2625
6 SASI_Rn02_00391744 predicted 5494
7 SASI_Rn02_00391745 predicted 802
8 SASI_Rn02_00391746 predicted 8163
9 SASI_Rn02_00391747 predicted 4828
10 SASI_Rn02_00391748 predicted 6924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199885 predicted 3763
2 SASI_Mm02_00314075 predicted 10663
3 SASI_Mm01_00199886 predicted 5256
4 SASI_Mm01_00199887 predicted 680
5 SASI_Mm01_00199888 predicted 2818
6 SASI_Mm01_00199890 predicted 13434
7 SASI_Mm01_00199891 predicted 8159
8 SASI_Mm01_00199892 predicted 8959
9 SASI_Mm01_00199893 predicted 13475
10 SASI_Mm01_00199894 predicted 9570
11 SASI_Mm01_00199889 predicted 13053
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008512
VALIDATED
LRP1 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008512.1-14655s1c1
Sequence:CCGGGCTGAACACATTCTTTGGTAACTCGAGTTACCAAAGAATGTGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008512.1-12753s1c1
Sequence:CCGGCGGAGTCACTTACATCAATAACTCGAGTTATTGATGTAAGTGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008512.1-4932s1c1
Sequence:CCGGGCGAACAAATACACTGGCTAACTCGAGTTAGCCAGTGTATTTGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008512.1-8926s1c1
Sequence:CCGGCGCTTGTGTATTCCCAAGCATCTCGAGATGCTTGGGAATACACAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008512.1-13855s1c1
Sequence:CCGGCCTACCTACAAGATGTATGAACTCGAGTTCATACATCTTGTAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-13511s21c1
Sequence:CCGGAGGCGCCTGTGTGGTCAATAACTCGAGTTATTGACCACACAGGCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-12773s21c1
Sequence:CCGGCGGAGTCACTTACATCAATAACTCGAGTTATTGATGTAAGTGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008512.2-14674s21c1
Sequence:CCGGGCTGAACACATTCTTTGGTAACTCGAGTTACCAAAGAATGTGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-13875s21c1
Sequence:CCGGCCTACCTACAAGATGTATGAACTCGAGTTCATACATCTTGTAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-11135s21c1
Sequence:CCGGCGACAACGACTGCGGAGATAACTCGAGTTATCTCCGCAGTCGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008512
VALIDATED
LRP1 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008512.1-14655s1c1
Sequence:CCGGGCTGAACACATTCTTTGGTAACTCGAGTTACCAAAGAATGTGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008512.1-12753s1c1
Sequence:CCGGCGGAGTCACTTACATCAATAACTCGAGTTATTGATGTAAGTGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008512.1-4932s1c1
Sequence:CCGGGCGAACAAATACACTGGCTAACTCGAGTTAGCCAGTGTATTTGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008512.1-8926s1c1
Sequence:CCGGCGCTTGTGTATTCCCAAGCATCTCGAGATGCTTGGGAATACACAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008512.1-13855s1c1
Sequence:CCGGCCTACCTACAAGATGTATGAACTCGAGTTCATACATCTTGTAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-13511s21c1
Sequence:CCGGAGGCGCCTGTGTGGTCAATAACTCGAGTTATTGACCACACAGGCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-12773s21c1
Sequence:CCGGCGGAGTCACTTACATCAATAACTCGAGTTATTGATGTAAGTGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008512.2-14674s21c1
Sequence:CCGGGCTGAACACATTCTTTGGTAACTCGAGTTACCAAAGAATGTGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-13875s21c1
Sequence:CCGGCCTACCTACAAGATGTATGAACTCGAGTTCATACATCTTGTAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-11135s21c1
Sequence:CCGGCGACAACGACTGCGGAGATAACTCGAGTTATCTCCGCAGTCGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008512
VALIDATED
LRP1 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008512.1-14655s1c1
Sequence:CCGGGCTGAACACATTCTTTGGTAACTCGAGTTACCAAAGAATGTGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008512.1-12753s1c1
Sequence:CCGGCGGAGTCACTTACATCAATAACTCGAGTTATTGATGTAAGTGACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008512.1-4932s1c1
Sequence:CCGGGCGAACAAATACACTGGCTAACTCGAGTTAGCCAGTGTATTTGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008512.1-8926s1c1
Sequence:CCGGCGCTTGTGTATTCCCAAGCATCTCGAGATGCTTGGGAATACACAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008512.1-13855s1c1
Sequence:CCGGCCTACCTACAAGATGTATGAACTCGAGTTCATACATCTTGTAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-13511s21c1
Sequence:CCGGAGGCGCCTGTGTGGTCAATAACTCGAGTTATTGACCACACAGGCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-12773s21c1
Sequence:CCGGCGGAGTCACTTACATCAATAACTCGAGTTATTGATGTAAGTGACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008512.2-14674s21c1
Sequence:CCGGGCTGAACACATTCTTTGGTAACTCGAGTTACCAAAGAATGTGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-13875s21c1
Sequence:CCGGCCTACCTACAAGATGTATGAACTCGAGTTCATACATCTTGTAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008512.2-11135s21c1
Sequence:CCGGCGACAACGACTGCGGAGATAACTCGAGTTATCTCCGCAGTCGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002332
VALIDATED
LRP1 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002332.1-14197s1c1
Sequence:CCGGCGCCGGATGTATAAATGTAAACTCGAGTTTACATTTATACATCCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002332.1-13780s1c1
Sequence:CCGGCGGAGTGGTATTCTGGTATAACTCGAGTTATACCAGAATACCACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002332.1-10090s1c1
Sequence:CCGGCCGCGAGGACTACATTGAATTCTCGAGAATTCAATGTAGTCCTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002332.1-3414s1c1
Sequence:CCGGCCTGCAACAATGGCAGATGTACTCGAGTACATCTGCCATTGTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002332.1-4954s1c1
Sequence:CCGGGCGAACAAACACACTGGCTAACTCGAGTTAGCCAGTGTGTTTGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-14479s21c1
Sequence:CCGGACAGCTTCCTGAGGGCTAATTCTCGAGAATTAGCCCTCAGGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-1619s21c1
Sequence:CCGGGATGCCTATCTGGACTATATTCTCGAGAATATAGTCCAGATAGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-1362s21c1
Sequence:GTACCGGACATCGATGATAGGATCTTTGCTCGAGCAAAGATCCTATCATCGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-9604s21c1
Sequence:CCGGGTCCAACTACACGTTACTTAACTCGAGTTAAGTAACGTGTAGTTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-1783s21c1
Sequence:CCGGGATCCGTGTGAACCGCTTTAACTCGAGTTAAAGCGGTTCACACGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002332
VALIDATED
LRP1 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002332.1-14197s1c1
Sequence:CCGGCGCCGGATGTATAAATGTAAACTCGAGTTTACATTTATACATCCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002332.1-13780s1c1
Sequence:CCGGCGGAGTGGTATTCTGGTATAACTCGAGTTATACCAGAATACCACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002332.1-10090s1c1
Sequence:CCGGCCGCGAGGACTACATTGAATTCTCGAGAATTCAATGTAGTCCTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002332.1-3414s1c1
Sequence:CCGGCCTGCAACAATGGCAGATGTACTCGAGTACATCTGCCATTGTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002332.1-4954s1c1
Sequence:CCGGGCGAACAAACACACTGGCTAACTCGAGTTAGCCAGTGTGTTTGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-14479s21c1
Sequence:CCGGACAGCTTCCTGAGGGCTAATTCTCGAGAATTAGCCCTCAGGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-1619s21c1
Sequence:CCGGGATGCCTATCTGGACTATATTCTCGAGAATATAGTCCAGATAGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-1362s21c1
Sequence:GTACCGGACATCGATGATAGGATCTTTGCTCGAGCAAAGATCCTATCATCGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-9604s21c1
Sequence:CCGGGTCCAACTACACGTTACTTAACTCGAGTTAAGTAACGTGTAGTTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-1783s21c1
Sequence:CCGGGATCCGTGTGAACCGCTTTAACTCGAGTTAAAGCGGTTCACACGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002332
VALIDATED
LRP1 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002332.1-14197s1c1
Sequence:CCGGCGCCGGATGTATAAATGTAAACTCGAGTTTACATTTATACATCCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002332.1-13780s1c1
Sequence:CCGGCGGAGTGGTATTCTGGTATAACTCGAGTTATACCAGAATACCACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002332.1-10090s1c1
Sequence:CCGGCCGCGAGGACTACATTGAATTCTCGAGAATTCAATGTAGTCCTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002332.1-3414s1c1
Sequence:CCGGCCTGCAACAATGGCAGATGTACTCGAGTACATCTGCCATTGTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002332.1-4954s1c1
Sequence:CCGGGCGAACAAACACACTGGCTAACTCGAGTTAGCCAGTGTGTTTGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-14479s21c1
Sequence:CCGGACAGCTTCCTGAGGGCTAATTCTCGAGAATTAGCCCTCAGGAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-1619s21c1
Sequence:CCGGGATGCCTATCTGGACTATATTCTCGAGAATATAGTCCAGATAGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-1362s21c1
Sequence:GTACCGGACATCGATGATAGGATCTTTGCTCGAGCAAAGATCCTATCATCGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-9604s21c1
Sequence:CCGGGTCCAACTACACGTTACTTAACTCGAGTTAAGTAACGTGTAGTTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002332.2-1783s21c1
Sequence:CCGGGATCCGTGTGAACCGCTTTAACTCGAGTTAAAGCGGTTCACACGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)