EMAIL THIS PAGE TO A FRIEND

LRP1B

low density lipoprotein receptor-related protein 1B

183 Gene Product Result for
Synonyms: LRP-DIT LRPDIT
UniProtKB ID: Q9NZR2, Q8WY29, Q8WY30, Q8WY31
Gene ID:
Human(53353) Summary: LRP1B belongs to the low density lipoprotein (LDL) receptor gene family. These receptors play a wide variety of roles in normal cell function and development due to their interactions with multiple ligands (Liu et al., 2001 [PubMed 11384978]
Mouse(94217) low density lipoprotein-related protein 1B (deleted in tumors)
Rat(311926) low density lipoprotein receptor-related protein 1B
Zebrafish(335186) low density lipoprotein receptor-related protein 1b
chicken(424301) low density lipoprotein receptor-related protein 1B
dog(476136) low density lipoprotein receptor-related protein 1B
cow(100336528) low density lipoprotein receptor-related protein 1B
sheep(101102124) low density lipoprotein receptor-related protein 1B
domestic guinea pig(100733178) low density lipoprotein receptor-related protein 1B
Domestic Rabbit(100343646) low density lipoprotein receptor-related protein 1B
naked mole-rat(101705699) low density lipoprotein receptor-related protein 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018557 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032891 MISSION® esiRNA esiRNA human LRP1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018557 Rosetta Predictions human pricing
NM_001107843 Rosetta Predictions rat pricing
NM_053011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243858 predicted 11871
2 SASI_Hs01_00243859 predicted 5933
3 SASI_Hs01_00243860 predicted 6912
4 SASI_Hs01_00243861 predicted 10525
5 SASI_Hs01_00243863 predicted 11746
6 SASI_Hs01_00243864 predicted 7601
7 SASI_Hs01_00243865 predicted 10450
8 SASI_Hs02_00352106 predicted 2440
9 SASI_Hs02_00352107 predicted 3604
10 SASI_Hs01_00243866 predicted 14635
11 SASI_Hs01_00243857 predicted 12794
12 SASI_Hs01_00243862 predicted 5256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232825 predicted 10164
2 SASI_Rn02_00232826 predicted 9841
3 SASI_Rn02_00232827 predicted 5590
4 SASI_Rn02_00232828 predicted 5264
5 SASI_Rn02_00232829 predicted 12421
6 SASI_Rn02_00232830 predicted 12860
7 SASI_Rn02_00232831 predicted 5338
8 SASI_Rn02_00232832 predicted 9926
9 SASI_Rn02_00232833 predicted 8712
10 SASI_Rn02_00232834 predicted 7212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126589 predicted 4197
2 SASI_Mm01_00126590 predicted 14326
3 SASI_Mm01_00126591 predicted 8773
4 SASI_Mm02_00337514 predicted 5260
5 SASI_Mm01_00126592 predicted 6174
6 SASI_Mm01_00126593 predicted 13031
7 SASI_Mm01_00126595 predicted 10690
8 SASI_Mm01_00126596 predicted 8745
9 SASI_Mm01_00126597 predicted 4611
10 SASI_Mm01_00126598 predicted 6002
11 SASI_Mm01_00126594 predicted 5332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053011
LRP1B MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 1B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-2113s1c1
Sequence:CCGGGCACTGATATTCACTCAATAACTCGAGTTATTGAGTGAATATCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-3280s1c1
Sequence:CCGGGCACGTTTAATCCTGAAGAAACTCGAGTTTCTTCAGGATTAAACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-13756s1c1
Sequence:CCGGGCCACCACTATTGTGTGAATTCTCGAGAATTCACACAATAGTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-1145s1c1
Sequence:CCGGGCAGTTGAATTGCCAGTTTAACTCGAGTTAAACTGGCAATTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-7422s1c1
Sequence:CCGGCCCTACGAGAACCCAAATTATCTCGAGATAATTTGGGTTCTCGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053011.2-5750s21c1
Sequence:CCGGGGACTGGGTTTCACGTAATTTCTCGAGAAATTACGTGAAACCCAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053011.2-6360s21c1
Sequence:CCGGATGTGTACAGTGGGATATTATCTCGAGATAATATCCCACTGTACACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053011
LRP1B MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 1B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-2113s1c1
Sequence:CCGGGCACTGATATTCACTCAATAACTCGAGTTATTGAGTGAATATCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-3280s1c1
Sequence:CCGGGCACGTTTAATCCTGAAGAAACTCGAGTTTCTTCAGGATTAAACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-13756s1c1
Sequence:CCGGGCCACCACTATTGTGTGAATTCTCGAGAATTCACACAATAGTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-1145s1c1
Sequence:CCGGGCAGTTGAATTGCCAGTTTAACTCGAGTTAAACTGGCAATTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-7422s1c1
Sequence:CCGGCCCTACGAGAACCCAAATTATCTCGAGATAATTTGGGTTCTCGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053011.2-5750s21c1
Sequence:CCGGGGACTGGGTTTCACGTAATTTCTCGAGAAATTACGTGAAACCCAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053011.2-6360s21c1
Sequence:CCGGATGTGTACAGTGGGATATTATCTCGAGATAATATCCCACTGTACACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053011
LRP1B MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 1B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-2113s1c1
Sequence:CCGGGCACTGATATTCACTCAATAACTCGAGTTATTGAGTGAATATCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-3280s1c1
Sequence:CCGGGCACGTTTAATCCTGAAGAAACTCGAGTTTCTTCAGGATTAAACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-13756s1c1
Sequence:CCGGGCCACCACTATTGTGTGAATTCTCGAGAATTCACACAATAGTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-1145s1c1
Sequence:CCGGGCAGTTGAATTGCCAGTTTAACTCGAGTTAAACTGGCAATTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053011.1-7422s1c1
Sequence:CCGGCCCTACGAGAACCCAAATTATCTCGAGATAATTTGGGTTCTCGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053011.2-5750s21c1
Sequence:CCGGGGACTGGGTTTCACGTAATTTCTCGAGAAATTACGTGAAACCCAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053011.2-6360s21c1
Sequence:CCGGATGTGTACAGTGGGATATTATCTCGAGATAATATCCCACTGTACACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018557
LRP1B MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-5765s1c1
Sequence:CCGGCGGCATTTACAGTCCCTGATACTCGAGTATCAGGGACTGTAAATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-12090s1c1
Sequence:CCGGCCCTGATATGTGTGTCAAATTCTCGAGAATTTGACACACATATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-11190s1c1
Sequence:CCGGCCAGAAATGTATCCCAGTAAACTCGAGTTTACTGGGATACATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-6282s1c1
Sequence:CCGGCGAGTCAATGAAAGAAGAATTCTCGAGAATTCTTCTTTCATTGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-1427s1c1
Sequence:CCGGGCTGTAAAGATCAAGATGAATCTCGAGATTCATCTTGATCTTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018557
LRP1B MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-5765s1c1
Sequence:CCGGCGGCATTTACAGTCCCTGATACTCGAGTATCAGGGACTGTAAATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-12090s1c1
Sequence:CCGGCCCTGATATGTGTGTCAAATTCTCGAGAATTTGACACACATATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-11190s1c1
Sequence:CCGGCCAGAAATGTATCCCAGTAAACTCGAGTTTACTGGGATACATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-6282s1c1
Sequence:CCGGCGAGTCAATGAAAGAAGAATTCTCGAGAATTCTTCTTTCATTGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-1427s1c1
Sequence:CCGGGCTGTAAAGATCAAGATGAATCTCGAGATTCATCTTGATCTTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018557
LRP1B MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-5765s1c1
Sequence:CCGGCGGCATTTACAGTCCCTGATACTCGAGTATCAGGGACTGTAAATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-12090s1c1
Sequence:CCGGCCCTGATATGTGTGTCAAATTCTCGAGAATTTGACACACATATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-11190s1c1
Sequence:CCGGCCAGAAATGTATCCCAGTAAACTCGAGTTTACTGGGATACATTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-6282s1c1
Sequence:CCGGCGAGTCAATGAAAGAAGAATTCTCGAGAATTCTTCTTTCATTGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018557.1-1427s1c1
Sequence:CCGGGCTGTAAAGATCAAGATGAATCTCGAGATTCATCTTGATCTTTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)