EMAIL THIS PAGE TO A FRIEND

LRP2

low density lipoprotein receptor-related protein 2

165 Gene Product Result for
Synonyms: DBS GP330
UniProtKB ID: P98164, O00711, Q16215
Gene ID:
Human(4036) Summary: The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
Mouse(14725) low density lipoprotein receptor-related protein 2
Rat(29216) low density lipoprotein receptor-related protein 2
chicken(424168) low density lipoprotein receptor-related protein 2
domestic cat(101087337) low density lipoprotein receptor-related protein 2
cow(100337021) low density lipoprotein receptor-related protein 2
Horse(100062836) low density lipoprotein receptor-related protein 2
dog(478781) low density lipoprotein receptor-related protein 2
naked mole-rat(101717800) low density lipoprotein receptor-related protein 2
Domestic Rabbit(100346275) low density lipoprotein receptor-related protein 2
domestic guinea pig(100713603) low density lipoprotein receptor-related protein 2
sheep(101108200) low density lipoprotein receptor-related protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004525 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081088 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081088 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081088 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MABS489 Anti-LRP-2/Megalin Antibody, clone 10D5.1 pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004525 Rosetta Predictions human pricing
NM_030827 Rosetta Predictions rat pricing
NM_001081088 Rosetta Predictions mouse pricing
XM_130308 Rosetta Predictions mouse pricing
XM_899846 Rosetta Predictions mouse pricing
XM_899854 Rosetta Predictions mouse pricing
XM_899859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061762 predicted 12930
2 SASI_Hs01_00061763 predicted 13697
3 SASI_Hs01_00061765 predicted 5125
4 SASI_Hs02_00337818 predicted 6263
5 SASI_Hs01_00061766 predicted 9980
6 SASI_Hs02_00337819 predicted 3716
7 SASI_Hs01_00061767 predicted 2363
8 SASI_Hs02_00337820 predicted 7586
9 SASI_Hs02_00337821 predicted 5575
10 SASI_Hs01_00061769 predicted 3687
11 SASI_Hs01_00061761 predicted 5963
12 SASI_Hs01_00061764 predicted 10168
13 SASI_Hs01_00061768 predicted 6931
14 SASI_Hs01_00061770 predicted 13753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090523 predicted 10513
2 SASI_Rn01_00090524 predicted 6631
3 SASI_Rn01_00090525 predicted 5304
4 SASI_Rn01_00090526 predicted 10396
5 SASI_Rn01_00090527 predicted 6480
6 SASI_Rn01_00090528 predicted 472
7 SASI_Rn01_00090530 predicted 9462
8 SASI_Rn01_00090531 predicted 4286
9 SASI_Rn02_00264033 predicted 7045
10 SASI_Rn02_00264034 predicted 7030
11 SASI_Rn01_00090529 predicted 495
12 SASI_Rn01_00090532 predicted 2957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295061 predicted 10561
2 SASI_Mm02_00295062 predicted 12552
3 SASI_Mm02_00295063 predicted 7127
4 SASI_Mm02_00295064 predicted 9611
5 SASI_Mm02_00295065 predicted 6193
6 SASI_Mm02_00295066 predicted 1707
7 SASI_Mm02_00295067 predicted 7185
8 SASI_Mm02_00295068 predicted 2191
9 SASI_Mm02_00295069 predicted 12652
10 SASI_Mm02_00295070 predicted 6684
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270986 predicted 10565
2 SASI_Mm01_00270987 predicted 12555
3 SASI_Mm01_00270988 predicted 7130
4 SASI_Mm01_00270989 predicted 6397
5 SASI_Mm01_00270990 predicted 9621
6 SASI_Mm01_00270991 predicted 6848
7 SASI_Mm01_00270992 predicted 6201
8 SASI_Mm01_00270993 predicted 1713
9 SASI_Mm01_00270994 predicted 2195
10 SASI_Mm01_00270995 predicted 12663
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215187 predicted 1913
2 SASI_Mm01_00215188 predicted 662
3 SASI_Mm01_00215189 predicted 600
4 SASI_Mm01_00215190 predicted 1620
5 SASI_Mm01_00215191 predicted 2979
6 SASI_Mm01_00215192 predicted 1417
7 SASI_Mm01_00215193 predicted 1716
8 SASI_Mm01_00215194 predicted 3654
9 SASI_Mm01_00215195 predicted 2202
10 SASI_Mm01_00215196 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225374 predicted 1912
2 SASI_Mm01_00225375 predicted 665
3 SASI_Mm01_00225376 predicted 597
4 SASI_Mm01_00225377 predicted 1620
5 SASI_Mm01_00225378 predicted 2970
6 SASI_Mm01_00225379 predicted 1416
7 SASI_Mm01_00225380 predicted 1707
8 SASI_Mm01_00225381 predicted 3654
9 SASI_Mm01_00225382 predicted 2192
10 SASI_Mm01_00225383 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208556 predicted 10562
2 SASI_Mm01_00208557 predicted 12558
3 SASI_Mm01_00208558 predicted 7132
4 SASI_Mm01_00208559 predicted 6393
5 SASI_Mm01_00208560 predicted 9617
6 SASI_Mm01_00208561 predicted 6848
7 SASI_Mm01_00208562 predicted 6204
8 SASI_Mm01_00208563 predicted 1712
9 SASI_Mm01_00208564 predicted 2194
10 SASI_Mm01_00208565 predicted 12663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004525
LRP2 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004525.2-1908s21c1
Sequence:CCGGTATGATATCGAAGCGTGTTTACTCGAGTAAACACGCTTCGATATCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004525.2-1709s21c1
Sequence:CCGGGCTATCGGGTTACCCTTATAACTCGAGTTATAAGGGTAACCCGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-1308s1c1
Sequence:CCGGCGGGATTTGTTAATTGGTGATCTCGAGATCACCAATTAACAAATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-5568s1c1
Sequence:CCGGCCTTCTATGAACCTGGCCTTACTCGAGTAAGGCCAGGTTCATAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-2691s1c1
Sequence:CCGGCCTGTAATAAACACTACTCTTCTCGAGAAGAGTAGTGTTTATTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-7041s1c1
Sequence:CCGGCCCACAGTGATAAGAGACAATCTCGAGATTGTCTCTTATCACTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-12483s1c1
Sequence:CCGGCGCAATAATCTTGTGCAGGAACTCGAGTTCCTGCACAAGATTATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004525
LRP2 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004525.2-1908s21c1
Sequence:CCGGTATGATATCGAAGCGTGTTTACTCGAGTAAACACGCTTCGATATCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004525.2-1709s21c1
Sequence:CCGGGCTATCGGGTTACCCTTATAACTCGAGTTATAAGGGTAACCCGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-1308s1c1
Sequence:CCGGCGGGATTTGTTAATTGGTGATCTCGAGATCACCAATTAACAAATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-5568s1c1
Sequence:CCGGCCTTCTATGAACCTGGCCTTACTCGAGTAAGGCCAGGTTCATAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-2691s1c1
Sequence:CCGGCCTGTAATAAACACTACTCTTCTCGAGAAGAGTAGTGTTTATTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-7041s1c1
Sequence:CCGGCCCACAGTGATAAGAGACAATCTCGAGATTGTCTCTTATCACTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-12483s1c1
Sequence:CCGGCGCAATAATCTTGTGCAGGAACTCGAGTTCCTGCACAAGATTATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004525
LRP2 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004525.2-1908s21c1
Sequence:CCGGTATGATATCGAAGCGTGTTTACTCGAGTAAACACGCTTCGATATCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004525.2-1709s21c1
Sequence:CCGGGCTATCGGGTTACCCTTATAACTCGAGTTATAAGGGTAACCCGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-1308s1c1
Sequence:CCGGCGGGATTTGTTAATTGGTGATCTCGAGATCACCAATTAACAAATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-5568s1c1
Sequence:CCGGCCTTCTATGAACCTGGCCTTACTCGAGTAAGGCCAGGTTCATAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-2691s1c1
Sequence:CCGGCCTGTAATAAACACTACTCTTCTCGAGAAGAGTAGTGTTTATTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-7041s1c1
Sequence:CCGGCCCACAGTGATAAGAGACAATCTCGAGATTGTCTCTTATCACTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004525.1-12483s1c1
Sequence:CCGGCGCAATAATCTTGTGCAGGAACTCGAGTTCCTGCACAAGATTATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081088
LRP2 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-10554s21c1
Sequence:CCGGTCCATACCGGCAGCCGATTATCTCGAGATAATCGGCTGCCGGTATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-2198s21c1
Sequence:CCGGTTAGTCACAGGACGGATAATGCTCGAGCATTATCCGTCCTGTGACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-6901s21c1
Sequence:CCGGGACCATGACACTGGCTATATTCTCGAGAATATAGCCAGTGTCATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-6558s21c1
Sequence:CCGGCAAACCCAACGGGTCTAATTTCTCGAGAAATTAGACCCGTTGGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081088.1-15248s21c1
Sequence:CCGGCGGTTTCTCTGTGCTAATATTCTCGAGAATATTAGCACAGAGAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081088
LRP2 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-10554s21c1
Sequence:CCGGTCCATACCGGCAGCCGATTATCTCGAGATAATCGGCTGCCGGTATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-2198s21c1
Sequence:CCGGTTAGTCACAGGACGGATAATGCTCGAGCATTATCCGTCCTGTGACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-6901s21c1
Sequence:CCGGGACCATGACACTGGCTATATTCTCGAGAATATAGCCAGTGTCATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-6558s21c1
Sequence:CCGGCAAACCCAACGGGTCTAATTTCTCGAGAAATTAGACCCGTTGGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081088.1-15248s21c1
Sequence:CCGGCGGTTTCTCTGTGCTAATATTCTCGAGAATATTAGCACAGAGAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081088
LRP2 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-10554s21c1
Sequence:CCGGTCCATACCGGCAGCCGATTATCTCGAGATAATCGGCTGCCGGTATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-2198s21c1
Sequence:CCGGTTAGTCACAGGACGGATAATGCTCGAGCATTATCCGTCCTGTGACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-6901s21c1
Sequence:CCGGGACCATGACACTGGCTATATTCTCGAGAATATAGCCAGTGTCATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081088.1-6558s21c1
Sequence:CCGGCAAACCCAACGGGTCTAATTTCTCGAGAAATTAGACCCGTTGGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081088.1-15248s21c1
Sequence:CCGGCGGTTTCTCTGTGCTAATATTCTCGAGAATATTAGCACAGAGAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)