EMAIL THIS PAGE TO A FRIEND

LRP2BP

LRP2 binding protein

70 Gene Product Result for
UniProtKB ID: Q9P2M1, A6NJR7, A7E219, B3KX83, Q9NSN6
Gene ID:
Mouse(67620) Lrp2 binding protein
Rat(290753) Lrp2 binding protein
Zebrafish(100073340) LRP2 binding protein
chicken(422543) LRP2 binding protein
domestic cat(101091864) LRP2 binding protein
cow(536490) LRP2 binding protein
Horse(100057415) LRP2 binding protein
dog(475628) LRP2 binding protein
sheep(101112284) LRP2 binding protein
domestic guinea pig(100727769) LRP2 binding protein
naked mole-rat(101708218) LRP2 binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018409 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018409 Rosetta Predictions human pricing
NM_001017443 Rosetta Predictions rat pricing
NM_026278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237176 predicted 918
2 SASI_Hs01_00237177 predicted 1820
3 SASI_Hs01_00237178 predicted 1845
4 SASI_Hs01_00237179 predicted 1911
5 SASI_Hs01_00237180 predicted 1752
6 SASI_Hs01_00237181 predicted 1334
7 SASI_Hs01_00237182 predicted 1620
8 SASI_Hs01_00237183 predicted 1554
9 SASI_Hs01_00237184 predicted 1086
10 SASI_Hs01_00237185 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038359 predicted 778
2 SASI_Rn01_00038360 predicted 278
3 SASI_Rn01_00038361 predicted 1179
4 SASI_Rn01_00038362 predicted 439
5 SASI_Rn01_00038363 predicted 1043
6 SASI_Rn01_00038364 predicted 985
7 SASI_Rn01_00038365 predicted 701
8 SASI_Rn01_00038366 predicted 241
9 SASI_Rn01_00038367 predicted 1243
10 SASI_Rn01_00038368 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031673 predicted 450
2 SASI_Mm01_00031674 predicted 1237
3 SASI_Mm01_00031675 predicted 312
4 SASI_Mm01_00031676 predicted 1211
5 SASI_Mm01_00031677 predicted 1218
6 SASI_Mm01_00031678 predicted 1261
7 SASI_Mm01_00031679 predicted 587
8 SASI_Mm01_00031680 predicted 734
9 SASI_Mm01_00031681 predicted 814
10 SASI_Mm01_00031682 predicted 1230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018409
LRP2BP MISSION shRNA Bacterial Glycerol Stock
LRP2 binding protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018409.3-1765s21c1
Sequence:CCGGCAACCGCTAAACACTATTATTCTCGAGAATAATAGTGTTTAGCGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018409.2-4847s1c1
Sequence:CCGGCCTCACTTCAAGCACTAATTTCTCGAGAAATTAGTGCTTGAAGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-1815s1c1
Sequence:CCGGGCAGATGAACTTCACTCCTTACTCGAGTAAGGAGTGAAGTTCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-1818s1c1
Sequence:CCGGGATGAACTTCACTCCTTACTTCTCGAGAAGTAAGGAGTGAAGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-1073s1c1
Sequence:CCGGGAAAGACCATCAAGCAACTTACTCGAGTAAGTTGCTTGATGGTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-861s1c1
Sequence:CCGGGTATCTCAGTATGCTGCTAAACTCGAGTTTAGCAGCATACTGAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018409.3-2126s21c1
Sequence:CCGGTATACAGCAAGTATCGTTTATCTCGAGATAAACGATACTTGCTGTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018409.3-1223s21c1
Sequence:CCGGCAACCTCGGAAGAGCTTATTACTCGAGTAATAAGCTCTTCCGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018409.3-1555s21c1
Sequence:CCGGATCTCGTGGAGTATTACTATACTCGAGTATAGTAATACTCCACGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018409.2-2096s1c1
Sequence:CCGGCCGAGACCATATCAAGTATTACTCGAGTAATACTTGATATGGTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018409.2-3712s1c1
Sequence:CCGGGCCCTAAGTAAAGAGCACTTTCTCGAGAAAGTGCTCTTTACTTAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-993s1c1
Sequence:CCGGGCATATTTCCTACGAGGTCAACTCGAGTTGACCTCGTAGGAAATATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018409
LRP2BP MISSION shRNA shRNA Plasmid DNA
LRP2 binding protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018409.3-1765s21c1
Sequence:CCGGCAACCGCTAAACACTATTATTCTCGAGAATAATAGTGTTTAGCGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018409.2-4847s1c1
Sequence:CCGGCCTCACTTCAAGCACTAATTTCTCGAGAAATTAGTGCTTGAAGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-1815s1c1
Sequence:CCGGGCAGATGAACTTCACTCCTTACTCGAGTAAGGAGTGAAGTTCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-1818s1c1
Sequence:CCGGGATGAACTTCACTCCTTACTTCTCGAGAAGTAAGGAGTGAAGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-1073s1c1
Sequence:CCGGGAAAGACCATCAAGCAACTTACTCGAGTAAGTTGCTTGATGGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-861s1c1
Sequence:CCGGGTATCTCAGTATGCTGCTAAACTCGAGTTTAGCAGCATACTGAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018409.3-2126s21c1
Sequence:CCGGTATACAGCAAGTATCGTTTATCTCGAGATAAACGATACTTGCTGTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018409.3-1223s21c1
Sequence:CCGGCAACCTCGGAAGAGCTTATTACTCGAGTAATAAGCTCTTCCGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018409.3-1555s21c1
Sequence:CCGGATCTCGTGGAGTATTACTATACTCGAGTATAGTAATACTCCACGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018409.2-2096s1c1
Sequence:CCGGCCGAGACCATATCAAGTATTACTCGAGTAATACTTGATATGGTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018409.2-3712s1c1
Sequence:CCGGGCCCTAAGTAAAGAGCACTTTCTCGAGAAAGTGCTCTTTACTTAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-993s1c1
Sequence:CCGGGCATATTTCCTACGAGGTCAACTCGAGTTGACCTCGTAGGAAATATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018409
LRP2BP MISSION shRNA Lentiviral Transduction Particles
LRP2 binding protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018409.3-1765s21c1
Sequence:CCGGCAACCGCTAAACACTATTATTCTCGAGAATAATAGTGTTTAGCGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018409.2-4847s1c1
Sequence:CCGGCCTCACTTCAAGCACTAATTTCTCGAGAAATTAGTGCTTGAAGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-1815s1c1
Sequence:CCGGGCAGATGAACTTCACTCCTTACTCGAGTAAGGAGTGAAGTTCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-1818s1c1
Sequence:CCGGGATGAACTTCACTCCTTACTTCTCGAGAAGTAAGGAGTGAAGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-1073s1c1
Sequence:CCGGGAAAGACCATCAAGCAACTTACTCGAGTAAGTTGCTTGATGGTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-861s1c1
Sequence:CCGGGTATCTCAGTATGCTGCTAAACTCGAGTTTAGCAGCATACTGAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018409.3-2126s21c1
Sequence:CCGGTATACAGCAAGTATCGTTTATCTCGAGATAAACGATACTTGCTGTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018409.3-1223s21c1
Sequence:CCGGCAACCTCGGAAGAGCTTATTACTCGAGTAATAAGCTCTTCCGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018409.3-1555s21c1
Sequence:CCGGATCTCGTGGAGTATTACTATACTCGAGTATAGTAATACTCCACGAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018409.2-2096s1c1
Sequence:CCGGCCGAGACCATATCAAGTATTACTCGAGTAATACTTGATATGGTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149614    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018409.2-3712s1c1
Sequence:CCGGGCCCTAAGTAAAGAGCACTTTCTCGAGAAAGTGCTCTTTACTTAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018409.2-993s1c1
Sequence:CCGGGCATATTTCCTACGAGGTCAACTCGAGTTGACCTCGTAGGAAATATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026278
LRP2BP MISSION shRNA Bacterial Glycerol Stock
LRP2 binding protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-1175s21c1
Sequence:CCGGGCCAAGCACTACTACTCTAAACTCGAGTTTAGAGTAGTAGTGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026278.2-1175s1c1
Sequence:CCGGGCCAAGCACTACTACTCTAAACTCGAGTTTAGAGTAGTAGTGCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026278.2-1270s1c1
Sequence:CCGGGCATTCTGTCAAAGAACTTAACTCGAGTTAAGTTCTTTGACAGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026278.3-2466s21c1
Sequence:CCGGTCTATTCTCATGAGCTATAAACTCGAGTTTATAGCTCATGAGAATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026278.2-1030s1c1
Sequence:CCGGCTATGATGAAGTCCACGACATCTCGAGATGTCGTGGACTTCATCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026278.3-1153s1c1
Sequence:CCGGCATCATGAAAGACGAAGAATCCTCGAGGATTCTTCGTCTTTCATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-323s21c1
Sequence:CCGGTATTACCTCCACGCTAATTTGCTCGAGCAAATTAGCGTGGAGGTAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-1199s21c1
Sequence:CCGGTGCCGTCTGAACCCTACATTGCTCGAGCAATGTAGGGTTCAGACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-406s21c1
Sequence:CCGGTCTAAGAGGCCAACTCTATTTCTCGAGAAATAGAGTTGGCCTCTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026278
LRP2BP MISSION shRNA shRNA Plasmid DNA
LRP2 binding protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-1175s21c1
Sequence:CCGGGCCAAGCACTACTACTCTAAACTCGAGTTTAGAGTAGTAGTGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026278.2-1175s1c1
Sequence:CCGGGCCAAGCACTACTACTCTAAACTCGAGTTTAGAGTAGTAGTGCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026278.2-1270s1c1
Sequence:CCGGGCATTCTGTCAAAGAACTTAACTCGAGTTAAGTTCTTTGACAGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026278.3-2466s21c1
Sequence:CCGGTCTATTCTCATGAGCTATAAACTCGAGTTTATAGCTCATGAGAATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026278.2-1030s1c1
Sequence:CCGGCTATGATGAAGTCCACGACATCTCGAGATGTCGTGGACTTCATCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026278.3-1153s1c1
Sequence:CCGGCATCATGAAAGACGAAGAATCCTCGAGGATTCTTCGTCTTTCATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-323s21c1
Sequence:CCGGTATTACCTCCACGCTAATTTGCTCGAGCAAATTAGCGTGGAGGTAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-1199s21c1
Sequence:CCGGTGCCGTCTGAACCCTACATTGCTCGAGCAATGTAGGGTTCAGACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-406s21c1
Sequence:CCGGTCTAAGAGGCCAACTCTATTTCTCGAGAAATAGAGTTGGCCTCTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026278
LRP2BP MISSION shRNA Lentiviral Transduction Particles
LRP2 binding protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-1175s21c1
Sequence:CCGGGCCAAGCACTACTACTCTAAACTCGAGTTTAGAGTAGTAGTGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026278.2-1175s1c1
Sequence:CCGGGCCAAGCACTACTACTCTAAACTCGAGTTTAGAGTAGTAGTGCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026278.2-1270s1c1
Sequence:CCGGGCATTCTGTCAAAGAACTTAACTCGAGTTAAGTTCTTTGACAGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026278.3-2466s21c1
Sequence:CCGGTCTATTCTCATGAGCTATAAACTCGAGTTTATAGCTCATGAGAATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026278.2-1030s1c1
Sequence:CCGGCTATGATGAAGTCCACGACATCTCGAGATGTCGTGGACTTCATCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026278.3-1153s1c1
Sequence:CCGGCATCATGAAAGACGAAGAATCCTCGAGGATTCTTCGTCTTTCATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-323s21c1
Sequence:CCGGTATTACCTCCACGCTAATTTGCTCGAGCAAATTAGCGTGGAGGTAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-1199s21c1
Sequence:CCGGTGCCGTCTGAACCCTACATTGCTCGAGCAATGTAGGGTTCAGACGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026278.3-406s21c1
Sequence:CCGGTCTAAGAGGCCAACTCTATTTCTCGAGAAATAGAGTTGGCCTCTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)