EMAIL THIS PAGE TO A FRIEND

LRP3

low density lipoprotein receptor-related protein 3

50 Gene Product Result for
UniProtKB ID: O75074, B3KQD6, B4DKF2
Gene ID:
Mouse(435965) low density lipoprotein receptor-related protein 3
Rat(89787) low density lipoprotein receptor-related protein 3
naked mole-rat(101696559) low density lipoprotein receptor-related protein 3
domestic guinea pig(100722704) low density lipoprotein receptor-related protein 3
sheep(101118045) low density lipoprotein receptor-related protein 3
chicken(415773) low density lipoprotein receptor-related protein 3
dog(484600) low density lipoprotein receptor-related protein 3
domestic cat(101083385) low density lipoprotein receptor-related protein 3
cow(100301323) low density lipoprotein receptor-related protein 3
Horse(100056284) low density lipoprotein receptor-related protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002333 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138851 MISSION® esiRNA esiRNA human LRP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002333 Rosetta Predictions human pricing
NM_053541 Rosetta Predictions rat pricing
NM_001024707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029408 predicted 1581
2 SASI_Hs02_00333648 predicted 2791
3 SASI_Hs01_00029409 predicted 347
4 SASI_Hs01_00029410 predicted 782
5 SASI_Hs01_00029411 predicted 1646
6 SASI_Hs01_00029412 predicted 355
7 SASI_Hs01_00029413 predicted 861
8 SASI_Hs01_00029414 predicted 581
9 SASI_Hs01_00029415 predicted 1587
10 SASI_Hs02_00333649 predicted 2797
11 SASI_Hs01_00029416 predicted 1123
12 SASI_Hs01_00029417 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102966 predicted 1854
2 SASI_Rn01_00102967 predicted 1444
3 SASI_Rn01_00102968 predicted 1751
4 SASI_Rn01_00102969 predicted 1957
5 SASI_Rn01_00102970 predicted 866
6 SASI_Rn01_00102971 predicted 1430
7 SASI_Rn01_00102972 predicted 1864
8 SASI_Rn01_00102973 predicted 876
9 SASI_Rn01_00102974 predicted 1670
10 SASI_Rn01_00102975 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287667 predicted 716
2 SASI_Mm02_00287668 predicted 1957
3 SASI_Mm02_00287669 predicted 1553
4 SASI_Mm02_00287670 predicted 737
5 SASI_Mm02_00287671 predicted 1975
6 SASI_Mm02_00287672 predicted 1860
7 SASI_Mm02_00287673 predicted 1540
8 SASI_Mm02_00287674 predicted 1773
9 SASI_Mm02_00287675 predicted 1380
10 SASI_Mm02_00287676 predicted 2099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002333
VALIDATED
LRP3 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-1785s21c1
Sequence:CCGGCGTGGAGGACTTTCCTGTCTACTCGAGTAGACAGGAAAGTCCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-2175s21c1
Sequence:CCGGGCCCGTGGACAAGGACAGAAACTCGAGTTTCTGTCCTTGTCCACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002333.3-2802s21c1
Sequence:CCGGTCTCATCCGTGGTGACTATTTCTCGAGAAATAGTCACCACGGATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-326s21c1
Sequence:CCGGGCGACCGTGGTGACATGATTACTCGAGTAATCATGTCACCACGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002333.1-1138s1c1
Sequence:CCGGTGACGACTACGTGCAGGTATACTCGAGTATACCTGCACGTAGTCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-1005s21c1
Sequence:CCGGTGACGACTACGTGCAGGTATACTCGAGTATACCTGCACGTAGTCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002333.1-2308s1c1
Sequence:CCGGGCCCGTGGACAAGGACAGAAACTCGAGTTTCTGTCCTTGTCCACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002333.1-685s1c1
Sequence:CCGGTCTGTCTTACATCCGAGGGAACTCGAGTTCCCTCGGATGTAAGACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002333.1-1918s1c1
Sequence:CCGGCGTGGAGGACTTTCCTGTCTACTCGAGTAGACAGGAAAGTCCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002333
VALIDATED
LRP3 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-1785s21c1
Sequence:CCGGCGTGGAGGACTTTCCTGTCTACTCGAGTAGACAGGAAAGTCCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-2175s21c1
Sequence:CCGGGCCCGTGGACAAGGACAGAAACTCGAGTTTCTGTCCTTGTCCACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002333.3-2802s21c1
Sequence:CCGGTCTCATCCGTGGTGACTATTTCTCGAGAAATAGTCACCACGGATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-326s21c1
Sequence:CCGGGCGACCGTGGTGACATGATTACTCGAGTAATCATGTCACCACGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002333.1-1138s1c1
Sequence:CCGGTGACGACTACGTGCAGGTATACTCGAGTATACCTGCACGTAGTCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-1005s21c1
Sequence:CCGGTGACGACTACGTGCAGGTATACTCGAGTATACCTGCACGTAGTCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002333.1-2308s1c1
Sequence:CCGGGCCCGTGGACAAGGACAGAAACTCGAGTTTCTGTCCTTGTCCACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002333.1-685s1c1
Sequence:CCGGTCTGTCTTACATCCGAGGGAACTCGAGTTCCCTCGGATGTAAGACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002333.1-1918s1c1
Sequence:CCGGCGTGGAGGACTTTCCTGTCTACTCGAGTAGACAGGAAAGTCCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002333
VALIDATED
LRP3 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-1785s21c1
Sequence:CCGGCGTGGAGGACTTTCCTGTCTACTCGAGTAGACAGGAAAGTCCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-2175s21c1
Sequence:CCGGGCCCGTGGACAAGGACAGAAACTCGAGTTTCTGTCCTTGTCCACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002333.3-2802s21c1
Sequence:CCGGTCTCATCCGTGGTGACTATTTCTCGAGAAATAGTCACCACGGATGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-326s21c1
Sequence:CCGGGCGACCGTGGTGACATGATTACTCGAGTAATCATGTCACCACGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002333.1-1138s1c1
Sequence:CCGGTGACGACTACGTGCAGGTATACTCGAGTATACCTGCACGTAGTCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002333.3-1005s21c1
Sequence:CCGGTGACGACTACGTGCAGGTATACTCGAGTATACCTGCACGTAGTCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002333.1-2308s1c1
Sequence:CCGGGCCCGTGGACAAGGACAGAAACTCGAGTTTCTGTCCTTGTCCACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002333.1-685s1c1
Sequence:CCGGTCTGTCTTACATCCGAGGGAACTCGAGTTCCCTCGGATGTAAGACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002333.1-1918s1c1
Sequence:CCGGCGTGGAGGACTTTCCTGTCTACTCGAGTAGACAGGAAAGTCCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024707
LRP3 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-1865s21c1
Sequence:CCGGGTACGAACCTGTGCATCTTTGCTCGAGCAAAGATGCACAGGTTCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-689s21c1
Sequence:CCGGCCAACTGCAGCTGGTACATTCCTCGAGGAATGTACCAGCTGCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-992s21c1
Sequence:CCGGTCCGCTGTGACAACGGTAAATCTCGAGATTTACCGTTGTCACAGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024707.1-3541s21c1
Sequence:CCGGTAGCATTCACTCTGGTGATTTCTCGAGAAATCACCAGAGTGAATGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-1998s21c1
Sequence:CCGGATGCGGACTGCTGCTTGTTATCTCGAGATAACAAGCAGCAGTCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024707
LRP3 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-1865s21c1
Sequence:CCGGGTACGAACCTGTGCATCTTTGCTCGAGCAAAGATGCACAGGTTCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-689s21c1
Sequence:CCGGCCAACTGCAGCTGGTACATTCCTCGAGGAATGTACCAGCTGCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-992s21c1
Sequence:CCGGTCCGCTGTGACAACGGTAAATCTCGAGATTTACCGTTGTCACAGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024707.1-3541s21c1
Sequence:CCGGTAGCATTCACTCTGGTGATTTCTCGAGAAATCACCAGAGTGAATGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-1998s21c1
Sequence:CCGGATGCGGACTGCTGCTTGTTATCTCGAGATAACAAGCAGCAGTCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024707
LRP3 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-1865s21c1
Sequence:CCGGGTACGAACCTGTGCATCTTTGCTCGAGCAAAGATGCACAGGTTCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-689s21c1
Sequence:CCGGCCAACTGCAGCTGGTACATTCCTCGAGGAATGTACCAGCTGCAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-992s21c1
Sequence:CCGGTCCGCTGTGACAACGGTAAATCTCGAGATTTACCGTTGTCACAGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024707.1-3541s21c1
Sequence:CCGGTAGCATTCACTCTGGTGATTTCTCGAGAAATCACCAGAGTGAATGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024707.1-1998s21c1
Sequence:CCGGATGCGGACTGCTGCTTGTTATCTCGAGATAACAAGCAGCAGTCCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)