EMAIL THIS PAGE TO A FRIEND

LRP4

low density lipoprotein receptor-related protein 4

251 Gene Product Result for
Synonyms: CLSS LRP-4 LRP10 MEGF7 SOST2
UniProtKB ID: O75096, B2RN39, Q4AC85, Q5KTZ5
Gene ID:
Human(4038) Summary: This gene encodes a member of the low-density lipoprotein receptor-related protein family. The encoded protein may be a regulator of Wnt signaling. Mutations in this gene are associated with Cenani-Lenz syndrome. [provided by RefSeq, May 2010]
Mouse(228357) low density lipoprotein receptor-related protein 4
Rat(83469) low density lipoprotein receptor-related protein 4
Zebrafish(100331602) low density lipoprotein receptor-related protein 4
chicken(423189) low density lipoprotein receptor-related protein 4
cow(504317) low density lipoprotein receptor-related protein 4
Horse(100057602) low density lipoprotein receptor-related protein 4
domestic cat(101085829) low density lipoprotein receptor-related protein 4
dog(483628) low density lipoprotein receptor-related protein 4
sheep(101118728) low density lipoprotein receptor-related protein 4
domestic guinea pig(100723072) low density lipoprotein receptor-related protein 4
naked mole-rat(101718455) low density lipoprotein receptor-related protein 4
Domestic Rabbit(100346254) low density lipoprotein receptor-related protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501188 Anti-LRP4 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA011934 Anti-LRP4 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA012300 Anti-LRP4 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5200636 Monoclonal Anti-Lrp4 (Cytoplasmic) antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200690 Monoclonal Anti-Lrp4 (Extracellular) antibody produced in mouse clone S207-27, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200645 Monoclonal Anti-Lrp4 - Alkaline Phosphatase antibody produced in mouse clone S164-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200699 Monoclonal Anti-Lrp4 - Alkaline Phosphatase antibody produced in mouse clone S207-27, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200646 Monoclonal Anti-Lrp4 - Apc antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200700 Monoclonal Anti-Lrp4 - Apc antibody produced in mouse clone S207-27, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200637 Monoclonal Anti-Lrp4 - Atto 390 antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200691 Monoclonal Anti-Lrp4 - Atto 390 antibody produced in mouse clone S207-27, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200638 Monoclonal Anti-Lrp4 - Atto 488 antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200692 Monoclonal Anti-Lrp4 - Atto 488 antibody produced in mouse clone S207-27, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200639 Monoclonal Anti-Lrp4 - Atto 565 antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200693 Monoclonal Anti-Lrp4 - Atto 565 antibody produced in mouse clone S207-27, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200640 Monoclonal Anti-Lrp4 - Atto 594 antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200694 Monoclonal Anti-Lrp4 - Atto 594 antibody produced in mouse clone S207-27, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200641 Monoclonal Anti-Lrp4 - Atto 633 antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200695 Monoclonal Anti-Lrp4 - Atto 633 antibody produced in mouse clone S207-27, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200642 Monoclonal Anti-Lrp4 - Atto 655 antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200696 Monoclonal Anti-Lrp4 - Atto 655 antibody produced in mouse clone S207-27, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200643 Monoclonal Anti-Lrp4 - Atto 680 antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200697 Monoclonal Anti-Lrp4 - Atto 680 antibody produced in mouse clone S207-27, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200644 Monoclonal Anti-Lrp4 - Atto 700 antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200698 Monoclonal Anti-Lrp4 - Atto 700 antibody produced in mouse clone S207-27, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200647 Monoclonal Anti-Lrp4 - Biotin antibody produced in mouse clone S164-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200701 Monoclonal Anti-Lrp4 - Biotin antibody produced in mouse clone S207-27, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200648 Monoclonal Anti-Lrp4 - Fitc antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200702 Monoclonal Anti-Lrp4 - Fitc antibody produced in mouse clone S207-27, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200649 Monoclonal Anti-Lrp4 - Hrp antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200703 Monoclonal Anti-Lrp4 - Hrp antibody produced in mouse clone S207-27, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200650 Monoclonal Anti-Lrp4 - Pe/Atto 594 antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200704 Monoclonal Anti-Lrp4 - Pe/Atto 594 antibody produced in mouse clone S207-27, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200651 Monoclonal Anti-Lrp4 - Percp antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200705 Monoclonal Anti-Lrp4 - Percp antibody produced in mouse clone S207-27, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200652 Monoclonal Anti-Lrp4 - Rpe antibody produced in mouse clone S164-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200706 Monoclonal Anti-Lrp4 - Rpe antibody produced in mouse clone S207-27, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200653 Monoclonal Anti-Lrp4 - Streptavidin antibody produced in mouse clone S164-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200707 Monoclonal Anti-Lrp4 - Streptavidin antibody produced in mouse clone S207-27, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_035037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_035037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_035037 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002334 Rosetta Predictions human pricing
NM_031322 Rosetta Predictions rat pricing
NM_172668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167687 predicted 3149
2 SASI_Hs02_00333650 predicted 2603
3 SASI_Hs01_00167691 predicted 2855
4 SASI_Hs01_00167692 predicted 2946
5 SASI_Hs02_00333651 predicted 5303
6 SASI_Hs02_00333652 predicted 1872
7 SASI_Hs02_00333653 predicted 3422
8 SASI_Hs01_00167694 predicted 3707
9 SASI_Hs01_00167696 predicted 1741
10 SASI_Hs01_00167695 predicted 3581
11 SASI_Hs01_00167688 predicted 1505
12 SASI_Hs01_00167689 predicted 3492
13 SASI_Hs01_00167690 predicted 761
14 SASI_Hs01_00167693 predicted 2266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058784 predicted 4267
2 SASI_Rn01_00058785 predicted 2000
3 SASI_Rn01_00058786 predicted 4361
4 SASI_Rn02_00264541 predicted 1781
5 SASI_Rn01_00058787 predicted 3441
6 SASI_Rn01_00058789 predicted 2689
7 SASI_Rn01_00058790 predicted 5424
8 SASI_Rn01_00058791 predicted 2717
9 SASI_Rn01_00058792 predicted 1524
10 SASI_Rn01_00058793 predicted 4381
11 SASI_Rn01_00058788 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150050 predicted 3959
2 SASI_Mm01_00150051 predicted 4343
3 SASI_Mm01_00150052 predicted 614
4 SASI_Mm01_00150053 predicted 2512
5 SASI_Mm01_00150054 predicted 1594
6 SASI_Mm01_00150055 predicted 4786
7 SASI_Mm01_00150056 predicted 1322
8 SASI_Mm01_00150057 predicted 3157
9 SASI_Mm01_00150058 predicted 2854
10 SASI_Mm01_00150059 predicted 4359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_035037
VALIDATED
LRP4 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000053308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-1294s1c1
Sequence:CCGGCGTGCCAAGATGTGAATGAATCTCGAGATTCATTCACATCTTGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-4273s1c1
Sequence:CCGGGCGTGGATGGAAAGGTCTATTCTCGAGAATAGACCTTTCCATCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-5489s1c1
Sequence:CCGGCCATAACTACACCAAGGAGAACTCGAGTTCTCCTTGGTGTAGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-2773s1c1
Sequence:CCGGGCCAAGTCATTATCTCTTCTACTCGAGTAGAAGAGATAATGACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_035037
VALIDATED
LRP4 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000053308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-1294s1c1
Sequence:CCGGCGTGCCAAGATGTGAATGAATCTCGAGATTCATTCACATCTTGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-4273s1c1
Sequence:CCGGGCGTGGATGGAAAGGTCTATTCTCGAGAATAGACCTTTCCATCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-5489s1c1
Sequence:CCGGCCATAACTACACCAAGGAGAACTCGAGTTCTCCTTGGTGTAGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-2773s1c1
Sequence:CCGGGCCAAGTCATTATCTCTTCTACTCGAGTAGAAGAGATAATGACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_035037
VALIDATED
LRP4 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000053308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-1294s1c1
Sequence:CCGGCGTGCCAAGATGTGAATGAATCTCGAGATTCATTCACATCTTGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-4273s1c1
Sequence:CCGGGCGTGGATGGAAAGGTCTATTCTCGAGAATAGACCTTTCCATCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-5489s1c1
Sequence:CCGGCCATAACTACACCAAGGAGAACTCGAGTTCTCCTTGGTGTAGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_035037.3-2773s1c1
Sequence:CCGGGCCAAGTCATTATCTCTTCTACTCGAGTAGAAGAGATAATGACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172668
LRP4 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172668.2-6989s1c1
Sequence:CCGGCCCTAGAATCTCATCCCAGTTCTCGAGAACTGGGATGAGATTCTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-5027s1c1
Sequence:CCGGCCACCACCTTACATTCTTCTACTCGAGTAGAAGAATGTAAGGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-2764s1c1
Sequence:CCGGGCCGGCATGAAGACTATTGAACTCGAGTTCAATAGTCTTCATGCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-1175s1c1
Sequence:CCGGCGTGCCAGGATGTAAACGAATCTCGAGATTCGTTTACATCCTGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-3508s1c1
Sequence:CCGGCGGGCCATTGTATTATACCATCTCGAGATGGTATAATACAATGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172668
LRP4 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172668.2-6989s1c1
Sequence:CCGGCCCTAGAATCTCATCCCAGTTCTCGAGAACTGGGATGAGATTCTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-5027s1c1
Sequence:CCGGCCACCACCTTACATTCTTCTACTCGAGTAGAAGAATGTAAGGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-2764s1c1
Sequence:CCGGGCCGGCATGAAGACTATTGAACTCGAGTTCAATAGTCTTCATGCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-1175s1c1
Sequence:CCGGCGTGCCAGGATGTAAACGAATCTCGAGATTCGTTTACATCCTGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-3508s1c1
Sequence:CCGGCGGGCCATTGTATTATACCATCTCGAGATGGTATAATACAATGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172668
LRP4 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172668.2-6989s1c1
Sequence:CCGGCCCTAGAATCTCATCCCAGTTCTCGAGAACTGGGATGAGATTCTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-5027s1c1
Sequence:CCGGCCACCACCTTACATTCTTCTACTCGAGTAGAAGAATGTAAGGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-2764s1c1
Sequence:CCGGGCCGGCATGAAGACTATTGAACTCGAGTTCAATAGTCTTCATGCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-1175s1c1
Sequence:CCGGCGTGCCAGGATGTAAACGAATCTCGAGATTCGTTTACATCCTGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172668.2-3508s1c1
Sequence:CCGGCGGGCCATTGTATTATACCATCTCGAGATGGTATAATACAATGGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)