EMAIL THIS PAGE TO A FRIEND

LRP5

low density lipoprotein receptor-related protein 5

54 Gene Product Result for
Synonyms: BMND1 EVR1 EVR4 HBM LR3 LRP7 OPPG OPS OPTA1 VBCH2
UniProtKB ID: O75197, Q96TD6, Q9UES7, Q9UP66
Gene ID:
Human(4041) Summary: This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. [provided by RefSeq, Nov 2009]
Mouse(16973) low density lipoprotein receptor-related protein 5
Rat(293649) low density lipoprotein receptor-related protein 5
Zebrafish(568518) low density lipoprotein receptor-related protein 5
cow(534450) low density lipoprotein receptor-related protein 5
Horse(100147353) low density lipoprotein receptor-related protein 5
domestic cat(101084481) low density lipoprotein receptor-related protein 5
dog(100306933) low density lipoprotein receptor-related protein 5
chicken(423114) low density lipoprotein receptor-related protein 5
Domestic Rabbit(100009566) low density lipoprotein receptor-related protein 5
naked mole-rat(101711921) low density lipoprotein receptor-related protein 5
domestic guinea pig(100714196) low density lipoprotein receptor-related protein 5
sheep(101113714) low density lipoprotein receptor-related protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002335 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU081381 MISSION® esiRNA esiRNA targeting mouse Lrp5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002335 siRNAs that have been validated in the lab human pricing
NM_001106321 Rosetta Predictions rat pricing
NM_008513 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002335 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086821 validated 3208
1 SASI_Hs01_00086820 validated 4752
2 SASI_Hs01_00086822 predicted 1644
3 SASI_Hs01_00086824 predicted 1419
4 SASI_Hs02_00333654 predicted 2438
5 SASI_Hs01_00086825 predicted 2672
6 SASI_Hs01_00086826 predicted 595
7 SASI_Hs01_00086827 predicted 2653
8 SASI_Hs01_00086828 predicted 1654
9 SASI_Hs01_00086829 predicted 4612
10 SASI_Hs01_00086823 predicted 1823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217818 predicted 2628
2 SASI_Rn02_00217819 predicted 4254
3 SASI_Rn02_00217820 predicted 2429
4 SASI_Rn02_00217821 predicted 1775
5 SASI_Rn02_00217822 predicted 3749
6 SASI_Rn02_00217823 predicted 2385
7 SASI_Rn02_00217824 predicted 1395
8 SASI_Rn02_00217825 predicted 1663
9 SASI_Rn02_00217826 predicted 2462
10 SASI_Rn02_00217827 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148755 predicted 4580
2 SASI_Mm01_00148756 predicted 1457
3 SASI_Mm01_00148757 predicted 2013
4 SASI_Mm01_00148758 predicted 2482
5 SASI_Mm01_00148759 predicted 4330
6 SASI_Mm01_00148760 predicted 2416
7 SASI_Mm01_00148761 predicted 2459
8 SASI_Mm01_00148762 predicted 1416
9 SASI_Mm01_00148763 predicted 1802
10 SASI_Mm01_00148764 predicted 2491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008513
VALIDATED
LRP5 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008513.1-2659s1c1
Sequence:CCGGCCTGACTCAATATAGCGATTACTCGAGTAATCGCTATATTGAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-3501s1c1
Sequence:CCGGCCGACCTAAAGCGAATCGAAACTCGAGTTTCGATTCGCTTTAGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-1232s1c1
Sequence:CCGGGCCATTGCCATTGACTACGATCTCGAGATCGTAGTCAATGGCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-2658s1c1
Sequence:CCGGGCCTGACTCAATATAGCGATTCTCGAGAATCGCTATATTGAGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-1865s1c1
Sequence:CCGGCCCGACCTGATGGGACTCAAACTCGAGTTTGAGTCCCATCAGGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008513
VALIDATED
LRP5 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008513.1-2659s1c1
Sequence:CCGGCCTGACTCAATATAGCGATTACTCGAGTAATCGCTATATTGAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-3501s1c1
Sequence:CCGGCCGACCTAAAGCGAATCGAAACTCGAGTTTCGATTCGCTTTAGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-1232s1c1
Sequence:CCGGGCCATTGCCATTGACTACGATCTCGAGATCGTAGTCAATGGCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-2658s1c1
Sequence:CCGGGCCTGACTCAATATAGCGATTCTCGAGAATCGCTATATTGAGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-1865s1c1
Sequence:CCGGCCCGACCTGATGGGACTCAAACTCGAGTTTGAGTCCCATCAGGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008513
VALIDATED
LRP5 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008513.1-2659s1c1
Sequence:CCGGCCTGACTCAATATAGCGATTACTCGAGTAATCGCTATATTGAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-3501s1c1
Sequence:CCGGCCGACCTAAAGCGAATCGAAACTCGAGTTTCGATTCGCTTTAGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-1232s1c1
Sequence:CCGGGCCATTGCCATTGACTACGATCTCGAGATCGTAGTCAATGGCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-2658s1c1
Sequence:CCGGGCCTGACTCAATATAGCGATTCTCGAGAATCGCTATATTGAGTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008513.1-1865s1c1
Sequence:CCGGCCCGACCTGATGGGACTCAAACTCGAGTTTGAGTCCCATCAGGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002335
VALIDATED
LRP5 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-4635s1c1
Sequence:CCGGGCCCTACATCATTCGAGGAATCTCGAGATTCCTCGAATGATGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-244s1c1
Sequence:CCGGGCCGCAGTGGACTTCCAGTTTCTCGAGAAACTGGAAGTCCACTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-3285s1c1
Sequence:CCGGGTACCTGTACTTCACCAACATCTCGAGATGTTGGTGAAGTACAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-4575s1c1
Sequence:CCGGCCTGTACAACATGGACATGTTCTCGAGAACATGTCCATGTTGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-2601s1c1
Sequence:CCGGGACGCAGTACAGCGATTATATCTCGAGATATAATCGCTGTACTGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-2996s21c1
Sequence:CCGGATGGACTGAGGAACGTCAAAGCTCGAGCTTTGACGTTCCTCAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-4268s21c1
Sequence:CCGGTCGTCATGGGTGGTGTCTATTCTCGAGAATAGACACCACCCATGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-2628s21c1
Sequence:CCGGGACGCAGTACAGCGATTATATCTCGAGATATAATCGCTGTACTGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-2776s21c1
Sequence:CCGGGATGGCCTCAATGACTGTATGCTCGAGCATACAGTCATTGAGGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002335
VALIDATED
LRP5 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-4635s1c1
Sequence:CCGGGCCCTACATCATTCGAGGAATCTCGAGATTCCTCGAATGATGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-244s1c1
Sequence:CCGGGCCGCAGTGGACTTCCAGTTTCTCGAGAAACTGGAAGTCCACTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-3285s1c1
Sequence:CCGGGTACCTGTACTTCACCAACATCTCGAGATGTTGGTGAAGTACAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-4575s1c1
Sequence:CCGGCCTGTACAACATGGACATGTTCTCGAGAACATGTCCATGTTGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-2601s1c1
Sequence:CCGGGACGCAGTACAGCGATTATATCTCGAGATATAATCGCTGTACTGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-2996s21c1
Sequence:CCGGATGGACTGAGGAACGTCAAAGCTCGAGCTTTGACGTTCCTCAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-4268s21c1
Sequence:CCGGTCGTCATGGGTGGTGTCTATTCTCGAGAATAGACACCACCCATGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-2628s21c1
Sequence:CCGGGACGCAGTACAGCGATTATATCTCGAGATATAATCGCTGTACTGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-2776s21c1
Sequence:CCGGGATGGCCTCAATGACTGTATGCTCGAGCATACAGTCATTGAGGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002335
VALIDATED
LRP5 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-4635s1c1
Sequence:CCGGGCCCTACATCATTCGAGGAATCTCGAGATTCCTCGAATGATGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-244s1c1
Sequence:CCGGGCCGCAGTGGACTTCCAGTTTCTCGAGAAACTGGAAGTCCACTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-3285s1c1
Sequence:CCGGGTACCTGTACTTCACCAACATCTCGAGATGTTGGTGAAGTACAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-4575s1c1
Sequence:CCGGCCTGTACAACATGGACATGTTCTCGAGAACATGTCCATGTTGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002335.1-2601s1c1
Sequence:CCGGGACGCAGTACAGCGATTATATCTCGAGATATAATCGCTGTACTGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-2996s21c1
Sequence:CCGGATGGACTGAGGAACGTCAAAGCTCGAGCTTTGACGTTCCTCAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-4268s21c1
Sequence:CCGGTCGTCATGGGTGGTGTCTATTCTCGAGAATAGACACCACCCATGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-2628s21c1
Sequence:CCGGGACGCAGTACAGCGATTATATCTCGAGATATAATCGCTGTACTGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002335.2-2776s21c1
Sequence:CCGGGATGGCCTCAATGACTGTATGCTCGAGCATACAGTCATTGAGGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)