EMAIL THIS PAGE TO A FRIEND

LRP6

low density lipoprotein receptor-related protein 6

90 Gene Product Result for
Synonyms: ADCAD2
UniProtKB ID: O75581, Q17RZ2
Gene ID:
Human(4040) Summary: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
Mouse(16974) low density lipoprotein receptor-related protein 6
Rat(312781) low density lipoprotein receptor-related protein 6
Zebrafish(100003877) low-density lipoprotein receptor-related protein 6
chicken(419097) low density lipoprotein receptor-related protein 6
dog(477692) low density lipoprotein receptor-related protein 6
domestic cat(101082246) low density lipoprotein receptor-related protein 6
Horse(100063409) low density lipoprotein receptor-related protein 6
cow(536328) low density lipoprotein receptor-related protein 6
sheep(101112971) low density lipoprotein receptor-related protein 6
domestic guinea pig(100735282) low density lipoprotein receptor-related protein 6
naked mole-rat(101703711) low density lipoprotein receptor-related protein 6
Domestic Rabbit(100352000) low density lipoprotein receptor-related protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1566 Human LRP-6 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002336 siRNAs that have been validated in the lab human pricing
NM_001107892 Rosetta Predictions rat pricing
NM_008514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002336 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039493 validated 3190
1 SASI_Hs01_00039492 validated 4740
1 SASI_Hs01_00039491 validated 2055
2 SASI_Hs02_00333655 predicted 2656
3 SASI_Hs01_00039494 predicted 576
4 SASI_Hs01_00039495 predicted 3990
5 SASI_Hs01_00039496 predicted 1675
6 SASI_Hs01_00039497 predicted 4324
7 SASI_Hs01_00039499 predicted 3497
8 SASI_Hs01_00039500 predicted 1873
9 SASI_Hs02_00333656 predicted 4182
10 SASI_Hs01_00039498 predicted 4303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233305 predicted 2291
2 SASI_Rn02_00233306 predicted 792
3 SASI_Rn02_00233307 predicted 934
4 SASI_Rn02_00233308 predicted 1287
5 SASI_Rn02_00233309 predicted 817
6 SASI_Rn02_00233310 predicted 2096
7 SASI_Rn02_00233311 predicted 3000
8 SASI_Rn02_00233312 predicted 1532
9 SASI_Rn02_00233313 predicted 2313
10 SASI_Rn02_00233314 predicted 3567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148895 predicted 3852
2 SASI_Mm01_00148896 predicted 3266
3 SASI_Mm02_00314076 predicted 794
4 SASI_Mm01_00148898 predicted 1202
5 SASI_Mm01_00148899 predicted 646
6 SASI_Mm01_00148901 predicted 1802
7 SASI_Mm01_00148902 predicted 2267
8 SASI_Mm01_00148903 predicted 3833
9 SASI_Mm01_00148904 predicted 3171
10 SASI_Mm02_00314077 predicted 1560
11 SASI_Mm01_00148897 predicted 3104
12 SASI_Mm01_00148900 predicted 4209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002336
VALIDATED
LRP6 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002336.1-2099s1c1
Sequence:CCGGCCGAATTTATTGGACTGATATCTCGAGATATCAGTCCAATAAATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002336.1-3447s1c1
Sequence:CCGGCGGCGAATTGAAAGCAGTGATCTCGAGATCACTGCTTTCAATTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002336.1-1231s1c1
Sequence:CCGGGCCGTTCATTTATAGATGGATCTCGAGATCCATCTATAAATGAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002336.1-2826s1c1
Sequence:CCGGCCTGCCCACTACTCTCTTAATCTCGAGATTAAGAGAGTAGTGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002336.2-5428s21c1
Sequence:CCGGGATAGCCTTCAGTTAACTAACCTCGAGGTTAGTTAACTGAAGGCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002336.2-236s21c1
Sequence:CCGGCGATTGGTTGATGCTACAAATCTCGAGATTTGTAGCATCAACCAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002336.2-1868s21c1
Sequence:CCGGATGGGCCTAAAGGCTACAAATCTCGAGATTTGTAGCCTTTAGGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002336.2-4057s21c1
Sequence:CCGGCCGATGCAATGGAGATGCAAACTCGAGTTTGCATCTCCATTGCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002336.2-2406s21c1
Sequence:CCGGTGGACCCTGCCGAAGGATTTACTCGAGTAAATCCTTCGGCAGGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002336
VALIDATED
LRP6 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002336.1-2099s1c1
Sequence:CCGGCCGAATTTATTGGACTGATATCTCGAGATATCAGTCCAATAAATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002336.1-3447s1c1
Sequence:CCGGCGGCGAATTGAAAGCAGTGATCTCGAGATCACTGCTTTCAATTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002336.1-1231s1c1
Sequence:CCGGGCCGTTCATTTATAGATGGATCTCGAGATCCATCTATAAATGAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002336.1-2826s1c1
Sequence:CCGGCCTGCCCACTACTCTCTTAATCTCGAGATTAAGAGAGTAGTGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002336.2-5428s21c1
Sequence:CCGGGATAGCCTTCAGTTAACTAACCTCGAGGTTAGTTAACTGAAGGCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002336.2-236s21c1
Sequence:CCGGCGATTGGTTGATGCTACAAATCTCGAGATTTGTAGCATCAACCAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002336.2-1868s21c1
Sequence:CCGGATGGGCCTAAAGGCTACAAATCTCGAGATTTGTAGCCTTTAGGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002336.2-4057s21c1
Sequence:CCGGCCGATGCAATGGAGATGCAAACTCGAGTTTGCATCTCCATTGCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002336.2-2406s21c1
Sequence:CCGGTGGACCCTGCCGAAGGATTTACTCGAGTAAATCCTTCGGCAGGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002336
VALIDATED
LRP6 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002336.1-2099s1c1
Sequence:CCGGCCGAATTTATTGGACTGATATCTCGAGATATCAGTCCAATAAATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002336.1-3447s1c1
Sequence:CCGGCGGCGAATTGAAAGCAGTGATCTCGAGATCACTGCTTTCAATTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002336.1-1231s1c1
Sequence:CCGGGCCGTTCATTTATAGATGGATCTCGAGATCCATCTATAAATGAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002336.1-2826s1c1
Sequence:CCGGCCTGCCCACTACTCTCTTAATCTCGAGATTAAGAGAGTAGTGGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002336.2-5428s21c1
Sequence:CCGGGATAGCCTTCAGTTAACTAACCTCGAGGTTAGTTAACTGAAGGCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002336.2-236s21c1
Sequence:CCGGCGATTGGTTGATGCTACAAATCTCGAGATTTGTAGCATCAACCAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002336.2-1868s21c1
Sequence:CCGGATGGGCCTAAAGGCTACAAATCTCGAGATTTGTAGCCTTTAGGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002336.2-4057s21c1
Sequence:CCGGCCGATGCAATGGAGATGCAAACTCGAGTTTGCATCTCCATTGCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002336.2-2406s21c1
Sequence:CCGGTGGACCCTGCCGAAGGATTTACTCGAGTAAATCCTTCGGCAGGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008514
VALIDATED
LRP6 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008514.1-2432s1c1
Sequence:CCGGCGCACTACATTAGTTCCAAATCTCGAGATTTGGAACTAATGTAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008514.1-1064s1c1
Sequence:CCGGGCCACTGAACTATTGCTGTTACTCGAGTAACAGCAATAGTTCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008514.1-305s1c1
Sequence:CCGGGCCATTAAACGAACAGAATTTCTCGAGAAATTCTGTTCGTTTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008514.1-5330s1c1
Sequence:CCGGGCAAACTTGGAAGTAGCCAAACTCGAGTTTGGCTACTTCCAAGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008514.1-4506s1c1
Sequence:CCGGCCAGTACCAAAGGCACTTATTCTCGAGAATAAGTGCCTTTGGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008514
VALIDATED
LRP6 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008514.1-2432s1c1
Sequence:CCGGCGCACTACATTAGTTCCAAATCTCGAGATTTGGAACTAATGTAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008514.1-1064s1c1
Sequence:CCGGGCCACTGAACTATTGCTGTTACTCGAGTAACAGCAATAGTTCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008514.1-305s1c1
Sequence:CCGGGCCATTAAACGAACAGAATTTCTCGAGAAATTCTGTTCGTTTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008514.1-5330s1c1
Sequence:CCGGGCAAACTTGGAAGTAGCCAAACTCGAGTTTGGCTACTTCCAAGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008514.1-4506s1c1
Sequence:CCGGCCAGTACCAAAGGCACTTATTCTCGAGAATAAGTGCCTTTGGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008514
VALIDATED
LRP6 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008514.1-2432s1c1
Sequence:CCGGCGCACTACATTAGTTCCAAATCTCGAGATTTGGAACTAATGTAGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008514.1-1064s1c1
Sequence:CCGGGCCACTGAACTATTGCTGTTACTCGAGTAACAGCAATAGTTCAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008514.1-305s1c1
Sequence:CCGGGCCATTAAACGAACAGAATTTCTCGAGAAATTCTGTTCGTTTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008514.1-5330s1c1
Sequence:CCGGGCAAACTTGGAAGTAGCCAAACTCGAGTTTGGCTACTTCCAAGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008514.1-4506s1c1
Sequence:CCGGCCAGTACCAAAGGCACTTATTCTCGAGAATAAGTGCCTTTGGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)