EMAIL THIS PAGE TO A FRIEND

LRP8

low density lipoprotein receptor-related protein 8, apolipoprotein e receptor

202 Gene Product Result for
Synonyms: APOER2 HSZ75190 LRP-8 MCI1
Gene ID:
Human(7804) Summary: This gene encodes a member of the low density lipoprotein receptor (LDLR) family. Low density lipoprotein receptors are cell surface proteins that play roles in both signal transduction and receptor-mediated endocytosis of specific ligands for lysosomal degradation. The encoded protein plays a critical role in the migration of neurons during development by mediating Reelin signaling, and also functions as a receptor for the cholesterol transport protein apolipoprotein E. Expression of this gene may be a marker for major depressive disorder. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]
Mouse(16975) low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Rat(362558) low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
naked mole-rat(101708688) low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
sheep(101116697) low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
chicken(396102) low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Horse(100060928) low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
cow(407179) low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
domestic cat(101094035) low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
dog(489584) low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004631 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018054 Rosetta Predictions human pricing
NM_004631 Rosetta Predictions human pricing
NM_017522 Rosetta Predictions human pricing
NM_033300 Rosetta Predictions human pricing
XM_001066578 Rosetta Predictions rat pricing
XM_342877 Rosetta Predictions rat pricing
NM_001080926 Rosetta Predictions mouse pricing
NM_053073 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115088 predicted 1999
2 SASI_Hs01_00115089 predicted 1537
3 SASI_Hs01_00115090 predicted 2012
4 SASI_Hs01_00115091 predicted 1868
5 SASI_Hs01_00115092 predicted 1361
6 SASI_Hs01_00115093 predicted 1544
7 SASI_Hs01_00115094 predicted 1692
8 SASI_Hs01_00115095 predicted 1967
9 SASI_Hs01_00115096 predicted 1933
10 SASI_Hs01_00115097 predicted 1985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121186 predicted 1992
2 SASI_Hs01_00121187 predicted 1535
3 SASI_Hs01_00121188 predicted 2014
4 SASI_Hs01_00121189 predicted 1873
5 SASI_Hs01_00121190 predicted 1358
6 SASI_Hs01_00121191 predicted 1541
7 SASI_Hs01_00121192 predicted 1691
8 SASI_Hs01_00121193 predicted 1968
9 SASI_Hs01_00121194 predicted 1937
10 SASI_Hs01_00121195 predicted 1988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023763 predicted 1613
2 SASI_Hs01_00023764 predicted 1152
3 SASI_Hs01_00023765 predicted 1628
4 SASI_Hs01_00023766 predicted 1486
5 SASI_Hs01_00023767 predicted 976
6 SASI_Hs01_00023768 predicted 1150
7 SASI_Hs01_00023769 predicted 1308
8 SASI_Hs01_00023770 predicted 1585
9 SASI_Hs01_00023771 predicted 1543
10 SASI_Hs01_00023772 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160565 predicted 1584
2 SASI_Hs01_00160566 predicted 1124
3 SASI_Hs01_00160567 predicted 1597
4 SASI_Hs01_00160568 predicted 1459
5 SASI_Hs01_00160569 predicted 940
6 SASI_Hs01_00160570 predicted 1125
7 SASI_Hs01_00160571 predicted 1284
8 SASI_Hs01_00160572 predicted 1556
9 SASI_Hs01_00160573 predicted 1518
10 SASI_Hs01_00160574 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318039 predicted 2269
2 SASI_Rn02_00318040 predicted 1243
3 SASI_Rn02_00318041 predicted 1424
4 SASI_Rn02_00318042 predicted 1415
5 SASI_Rn02_00318043 predicted 2262
6 SASI_Rn02_00318044 predicted 1630
7 SASI_Rn02_00318045 predicted 2904
8 SASI_Rn02_00318046 predicted 2873
9 SASI_Rn02_00318047 predicted 1465
10 SASI_Rn02_00318048 predicted 2074
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394941 predicted 463
2 SASI_Rn02_00394942 predicted 495
3 SASI_Rn02_00394943 predicted 492
4 SASI_Rn02_00394944 predicted 461
5 SASI_Rn02_00394945 predicted 494
6 SASI_Rn02_00394946 predicted 452
7 SASI_Rn02_00394947 predicted 473
8 SASI_Rn02_00394948 predicted 468
9 SASI_Rn02_00394949 predicted 411
10 SASI_Rn02_00394950 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293963 predicted 1038
2 SASI_Mm02_00293964 predicted 879
3 SASI_Mm02_00293965 predicted 2372
4 SASI_Mm02_00293966 predicted 1618
5 SASI_Mm02_00293967 predicted 2086
6 SASI_Mm02_00293968 predicted 2145
7 SASI_Mm02_00293969 predicted 930
8 SASI_Mm02_00293970 predicted 2487
9 SASI_Mm02_00293971 predicted 1077
10 SASI_Mm02_00293972 predicted 2517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070878 predicted 1425
2 SASI_Mm01_00070879 predicted 1254
3 SASI_Mm02_00337542 predicted 2749
4 SASI_Mm01_00070881 predicted 1993
5 SASI_Mm01_00070882 predicted 2459
6 SASI_Mm01_00070883 predicted 2515
7 SASI_Mm01_00070884 predicted 1303
8 SASI_Mm01_00070885 predicted 2872
9 SASI_Mm01_00070886 predicted 1462
10 SASI_Mm01_00070887 predicted 2894
11 SASI_Mm01_00070880 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004631
LRP8 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-1199s21c1
Sequence:CCGGGACCTCAAGATTGGCTTTGAACTCGAGTTCAAAGCCAATCTTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-1078s21c1
Sequence:CCGGCCTTGCAATCAAGCACTGCAACTCGAGTTGCAGTGCTTGATTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-1487s21c1
Sequence:CCGGCTCAAGAATGTCGTGGCACTACTCGAGTAGTGCCACGACATTCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-1172s1c1
Sequence:CCGGCCTTGCAATCAAGCACTGCAACTCGAGTTGCAGTGCTTGATTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-3090s1c1
Sequence:CCGGCGAGTGGCATTAAGCCTTGAACTCGAGTTCAAGGCTTAATGCCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-1581s1c1
Sequence:CCGGCTCAAGAATGTCGTGGCACTACTCGAGTAGTGCCACGACATTCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-1293s1c1
Sequence:CCGGGACCTCAAGATTGGCTTTGAACTCGAGTTCAAAGCCAATCTTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-2446s1c1
Sequence:CCGGCACCTCAATCTACCTCAACTACTCGAGTAGTTGAGGTAGATTGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-2352s21c1
Sequence:CCGGCACCTCAATCTACCTCAACTACTCGAGTAGTTGAGGTAGATTGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004631
LRP8 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-1199s21c1
Sequence:CCGGGACCTCAAGATTGGCTTTGAACTCGAGTTCAAAGCCAATCTTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-1078s21c1
Sequence:CCGGCCTTGCAATCAAGCACTGCAACTCGAGTTGCAGTGCTTGATTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-1487s21c1
Sequence:CCGGCTCAAGAATGTCGTGGCACTACTCGAGTAGTGCCACGACATTCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-1172s1c1
Sequence:CCGGCCTTGCAATCAAGCACTGCAACTCGAGTTGCAGTGCTTGATTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-3090s1c1
Sequence:CCGGCGAGTGGCATTAAGCCTTGAACTCGAGTTCAAGGCTTAATGCCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-1581s1c1
Sequence:CCGGCTCAAGAATGTCGTGGCACTACTCGAGTAGTGCCACGACATTCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-1293s1c1
Sequence:CCGGGACCTCAAGATTGGCTTTGAACTCGAGTTCAAAGCCAATCTTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-2446s1c1
Sequence:CCGGCACCTCAATCTACCTCAACTACTCGAGTAGTTGAGGTAGATTGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-2352s21c1
Sequence:CCGGCACCTCAATCTACCTCAACTACTCGAGTAGTTGAGGTAGATTGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004631
LRP8 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-1199s21c1
Sequence:CCGGGACCTCAAGATTGGCTTTGAACTCGAGTTCAAAGCCAATCTTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-1078s21c1
Sequence:CCGGCCTTGCAATCAAGCACTGCAACTCGAGTTGCAGTGCTTGATTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-1487s21c1
Sequence:CCGGCTCAAGAATGTCGTGGCACTACTCGAGTAGTGCCACGACATTCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-1172s1c1
Sequence:CCGGCCTTGCAATCAAGCACTGCAACTCGAGTTGCAGTGCTTGATTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-3090s1c1
Sequence:CCGGCGAGTGGCATTAAGCCTTGAACTCGAGTTCAAGGCTTAATGCCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-1581s1c1
Sequence:CCGGCTCAAGAATGTCGTGGCACTACTCGAGTAGTGCCACGACATTCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-1293s1c1
Sequence:CCGGGACCTCAAGATTGGCTTTGAACTCGAGTTCAAAGCCAATCTTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004631.2-2446s1c1
Sequence:CCGGCACCTCAATCTACCTCAACTACTCGAGTAGTTGAGGTAGATTGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004631.3-2352s21c1
Sequence:CCGGCACCTCAATCTACCTCAACTACTCGAGTAGTTGAGGTAGATTGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053073
LRP8 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2871s1c1
Sequence:CCGGGAGGAAGATGAGCTTCACATACTCGAGTATGTGAAGCTCATCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-3105s1c1
Sequence:CCGGCGAGTGGCATTAAGTCTTGAACTCGAGTTCAAGACTTAATGCCACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-1409s1c1
Sequence:CCGGCAGCCAAATCTGCGTGAATTACTCGAGTAATTCACGCAGATTTGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2264s1c1
Sequence:CCGGCCCACATGACATTGTAATCTTCTCGAGAAGATTACAATGTCATGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2819s1c1
Sequence:CCGGCAAGAGCATGAATTTCGACAACTCGAGTTGTCGAAATTCATGCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2069s1c1
Sequence:CCGGCCAACTATCCAGCATTGACTTCTCGAGAAGTCAATGCTGGATAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2250s1c1
Sequence:CCGGGAGAACCTCAATAACCCACATCTCGAGATGTGGGTTATTGAGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2924s1c1
Sequence:CCGGCGCAGCAATCAGCAACTATGACTCGAGTCATAGTTGCTGATTGCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2009s1c1
Sequence:CCGGCAATGGAATCACCCTGGACTTCTCGAGAAGTCCAGGGTGATTCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-1514s1c1
Sequence:CCGGCCCATCTCTGATCTTCACGAACTCGAGTTCGTGAAGATCAGAGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053073
LRP8 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2871s1c1
Sequence:CCGGGAGGAAGATGAGCTTCACATACTCGAGTATGTGAAGCTCATCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-3105s1c1
Sequence:CCGGCGAGTGGCATTAAGTCTTGAACTCGAGTTCAAGACTTAATGCCACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-1409s1c1
Sequence:CCGGCAGCCAAATCTGCGTGAATTACTCGAGTAATTCACGCAGATTTGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2264s1c1
Sequence:CCGGCCCACATGACATTGTAATCTTCTCGAGAAGATTACAATGTCATGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2819s1c1
Sequence:CCGGCAAGAGCATGAATTTCGACAACTCGAGTTGTCGAAATTCATGCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2069s1c1
Sequence:CCGGCCAACTATCCAGCATTGACTTCTCGAGAAGTCAATGCTGGATAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2250s1c1
Sequence:CCGGGAGAACCTCAATAACCCACATCTCGAGATGTGGGTTATTGAGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2924s1c1
Sequence:CCGGCGCAGCAATCAGCAACTATGACTCGAGTCATAGTTGCTGATTGCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2009s1c1
Sequence:CCGGCAATGGAATCACCCTGGACTTCTCGAGAAGTCCAGGGTGATTCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-1514s1c1
Sequence:CCGGCCCATCTCTGATCTTCACGAACTCGAGTTCGTGAAGATCAGAGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053073
LRP8 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2871s1c1
Sequence:CCGGGAGGAAGATGAGCTTCACATACTCGAGTATGTGAAGCTCATCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-3105s1c1
Sequence:CCGGCGAGTGGCATTAAGTCTTGAACTCGAGTTCAAGACTTAATGCCACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-1409s1c1
Sequence:CCGGCAGCCAAATCTGCGTGAATTACTCGAGTAATTCACGCAGATTTGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2264s1c1
Sequence:CCGGCCCACATGACATTGTAATCTTCTCGAGAAGATTACAATGTCATGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2819s1c1
Sequence:CCGGCAAGAGCATGAATTTCGACAACTCGAGTTGTCGAAATTCATGCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2069s1c1
Sequence:CCGGCCAACTATCCAGCATTGACTTCTCGAGAAGTCAATGCTGGATAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2250s1c1
Sequence:CCGGGAGAACCTCAATAACCCACATCTCGAGATGTGGGTTATTGAGGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2924s1c1
Sequence:CCGGCGCAGCAATCAGCAACTATGACTCGAGTCATAGTTGCTGATTGCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-2009s1c1
Sequence:CCGGCAATGGAATCACCCTGGACTTCTCGAGAAGTCCAGGGTGATTCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053073.1-1514s1c1
Sequence:CCGGCCCATCTCTGATCTTCACGAACTCGAGTTCGTGAAGATCAGAGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)