EMAIL THIS PAGE TO A FRIEND

LRPAP1

low density lipoprotein receptor-related protein associated protein 1

58 Gene Product Result for
Synonyms: A2MRAP A2RAP HBP44 MRAP RAP
UniProtKB ID: P30533, D3DVR9, Q2M310, Q53HQ3, Q53HS6
Gene ID:
Mouse(16976) low density lipoprotein receptor-related protein associated protein 1
Rat(116565) low density lipoprotein receptor-related protein associated protein 1
Zebrafish(333939) low density lipoprotein receptor-related protein associated protein 1
cow(504957) low density lipoprotein receptor-related protein associated protein 1
domestic cat(101087737) low density lipoprotein receptor-related protein associated protein 1
dog(479072) low density lipoprotein receptor-related protein associated protein 1
chicken(395936) low density lipoprotein receptor-related protein associated protein 1
sheep(101121173) low density lipoprotein receptor-related protein associated protein 1
domestic guinea pig(100712782) low density lipoprotein receptor-related protein associated protein 1
naked mole-rat(101724769) low density lipoprotein receptor-related protein associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA008001 Anti-LRPAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
AV45276 Anti-LRPAP1 antibody produced in rabbit IgG fraction of antiserum horse, rat, guinea pig, human, pig, mouse, bovine, canine
immunohistochemistry, western blot pricing
SAB2700842 Anti-LRPAP1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1658 Human RAP ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002337 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002337 Rosetta Predictions human pricing
XM_001058156 Rosetta Predictions rat pricing
XM_341239 Rosetta Predictions rat pricing
NM_013587 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152853 predicted 294
2 SASI_Hs01_00152854 predicted 993
3 SASI_Hs01_00152855 predicted 531
4 SASI_Hs01_00152856 predicted 1204
5 SASI_Hs01_00152857 predicted 475
6 SASI_Hs01_00152858 predicted 507
7 SASI_Hs02_00333657 predicted 593
8 SASI_Hs01_00152859 predicted 847
9 SASI_Hs01_00152860 predicted 208
10 SASI_Hs01_00152861 predicted 546
11 SASI_Hs01_00152862 predicted 196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288775 predicted 1119
2 SASI_Rn02_00288776 predicted 1179
3 SASI_Rn02_00288777 predicted 622
4 SASI_Rn02_00288778 predicted 695
5 SASI_Rn02_00288779 predicted 596
6 SASI_Rn02_00288780 predicted 1207
7 SASI_Rn02_00288781 predicted 740
8 SASI_Rn02_00288782 predicted 1064
9 SASI_Rn02_00288783 predicted 637
10 SASI_Rn02_00288784 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392633 predicted 1120
2 SASI_Rn02_00392634 predicted 1179
3 SASI_Rn02_00392635 predicted 622
4 SASI_Rn02_00392636 predicted 695
5 SASI_Rn02_00392637 predicted 602
6 SASI_Rn02_00392638 predicted 1202
7 SASI_Rn02_00392639 predicted 738
8 SASI_Rn02_00392640 predicted 1073
9 SASI_Rn02_00392641 predicted 637
10 SASI_Rn02_00392642 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126117 predicted 249
2 SASI_Mm01_00126118 predicted 278
3 SASI_Mm01_00126119 predicted 1051
4 SASI_Mm01_00126120 predicted 612
5 SASI_Mm02_00322327 predicted 1010
6 SASI_Mm01_00126121 predicted 1347
7 SASI_Mm01_00126122 predicted 1347
8 SASI_Mm01_00126123 predicted 532
9 SASI_Mm01_00126125 predicted 832
10 SASI_Mm01_00126126 predicted 484
11 SASI_Mm01_00126124 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002337
VALIDATED
LRPAP1 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein associated protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-598s1c1
Sequence:CCGGGACCGAAGAAATCCACGAGAACTCGAGTTCTCGTGGATTTCTTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-286s1c1
Sequence:CCGGCGCCTGGAAGAAACTAAAGCTCTCGAGAGCTTTAGTTTCTTCCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-1012s1c1
Sequence:CCGGGCTGGGCTACACGGTGAAGAACTCGAGTTCTTCACCGTGTAGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-172s1c1
Sequence:CCGGGTTCCGCATGGAGAAGTTGAACTCGAGTTCAACTTCTCCATGCGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-340s1c1
Sequence:CCGGGAGACTCATACGCAACCTCAACTCGAGTTGAGGTTGCGTATGAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-412s21c1
Sequence:CCGGGAGACTCATACGCAACCTCAACTCGAGTTGAGGTTGCGTATGAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-670s21c1
Sequence:CCGGGACCGAAGAAATCCACGAGAACTCGAGTTCTCGTGGATTTCTTCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-1084s21c1
Sequence:CCGGGCTGGGCTACACGGTGAAGAACTCGAGTTCTTCACCGTGTAGCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-244s21c1
Sequence:CCGGGTTCCGCATGGAGAAGTTGAACTCGAGTTCAACTTCTCCATGCGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002337
VALIDATED
LRPAP1 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein associated protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-598s1c1
Sequence:CCGGGACCGAAGAAATCCACGAGAACTCGAGTTCTCGTGGATTTCTTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-286s1c1
Sequence:CCGGCGCCTGGAAGAAACTAAAGCTCTCGAGAGCTTTAGTTTCTTCCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-1012s1c1
Sequence:CCGGGCTGGGCTACACGGTGAAGAACTCGAGTTCTTCACCGTGTAGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-172s1c1
Sequence:CCGGGTTCCGCATGGAGAAGTTGAACTCGAGTTCAACTTCTCCATGCGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-340s1c1
Sequence:CCGGGAGACTCATACGCAACCTCAACTCGAGTTGAGGTTGCGTATGAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-412s21c1
Sequence:CCGGGAGACTCATACGCAACCTCAACTCGAGTTGAGGTTGCGTATGAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-670s21c1
Sequence:CCGGGACCGAAGAAATCCACGAGAACTCGAGTTCTCGTGGATTTCTTCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-1084s21c1
Sequence:CCGGGCTGGGCTACACGGTGAAGAACTCGAGTTCTTCACCGTGTAGCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-244s21c1
Sequence:CCGGGTTCCGCATGGAGAAGTTGAACTCGAGTTCAACTTCTCCATGCGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002337
VALIDATED
LRPAP1 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein associated protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-598s1c1
Sequence:CCGGGACCGAAGAAATCCACGAGAACTCGAGTTCTCGTGGATTTCTTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-286s1c1
Sequence:CCGGCGCCTGGAAGAAACTAAAGCTCTCGAGAGCTTTAGTTTCTTCCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-1012s1c1
Sequence:CCGGGCTGGGCTACACGGTGAAGAACTCGAGTTCTTCACCGTGTAGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-172s1c1
Sequence:CCGGGTTCCGCATGGAGAAGTTGAACTCGAGTTCAACTTCTCCATGCGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002337.1-340s1c1
Sequence:CCGGGAGACTCATACGCAACCTCAACTCGAGTTGAGGTTGCGTATGAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-412s21c1
Sequence:CCGGGAGACTCATACGCAACCTCAACTCGAGTTGAGGTTGCGTATGAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-670s21c1
Sequence:CCGGGACCGAAGAAATCCACGAGAACTCGAGTTCTCGTGGATTTCTTCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-1084s21c1
Sequence:CCGGGCTGGGCTACACGGTGAAGAACTCGAGTTCTTCACCGTGTAGCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002337.2-244s21c1
Sequence:CCGGGTTCCGCATGGAGAAGTTGAACTCGAGTTCAACTTCTCCATGCGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013587
VALIDATED
LRPAP1 MISSION shRNA Bacterial Glycerol Stock
low density lipoprotein receptor-related protein associated protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-1213s1c1
Sequence:CCGGCCCTTGAAATACCAAGCTGATCTCGAGATCAGCTTGGTATTTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-966s1c1
Sequence:CCGGCAGCCGCAACAAGGAGAAATACTCGAGTATTTCTCCTTGTTGCGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-262s1c1
Sequence:CCGGCTGAAGATACAAGAGAGGGATCTCGAGATCCCTCTCTTGTATCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-535s1c1
Sequence:CCGGAGAGAGTTTCTGCATTACAAACTCGAGTTTGTAATGCAGAAACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-111s1c1
Sequence:CCGGCGGCAAGTACTCGCGAGAGAACTCGAGTTCTCTCGCGAGTACTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013587.2-1213s21c1
Sequence:CCGGCCCTTGAAATACCAAGCTGATCTCGAGATCAGCTTGGTATTTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-111s21c1
Sequence:CCGGCGGCAAGTACTCGCGAGAGAACTCGAGTTCTCTCGCGAGTACTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-966s21c1
Sequence:CCGGCAGCCGCAACAAGGAGAAATACTCGAGTATTTCTCCTTGTTGCGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-262s21c1
Sequence:CCGGCTGAAGATACAAGAGAGGGATCTCGAGATCCCTCTCTTGTATCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-535s21c1
Sequence:CCGGAGAGAGTTTCTGCATTACAAACTCGAGTTTGTAATGCAGAAACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013587
VALIDATED
LRPAP1 MISSION shRNA shRNA Plasmid DNA
low density lipoprotein receptor-related protein associated protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-1213s1c1
Sequence:CCGGCCCTTGAAATACCAAGCTGATCTCGAGATCAGCTTGGTATTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-966s1c1
Sequence:CCGGCAGCCGCAACAAGGAGAAATACTCGAGTATTTCTCCTTGTTGCGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-262s1c1
Sequence:CCGGCTGAAGATACAAGAGAGGGATCTCGAGATCCCTCTCTTGTATCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-535s1c1
Sequence:CCGGAGAGAGTTTCTGCATTACAAACTCGAGTTTGTAATGCAGAAACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-111s1c1
Sequence:CCGGCGGCAAGTACTCGCGAGAGAACTCGAGTTCTCTCGCGAGTACTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013587.2-1213s21c1
Sequence:CCGGCCCTTGAAATACCAAGCTGATCTCGAGATCAGCTTGGTATTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-111s21c1
Sequence:CCGGCGGCAAGTACTCGCGAGAGAACTCGAGTTCTCTCGCGAGTACTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-966s21c1
Sequence:CCGGCAGCCGCAACAAGGAGAAATACTCGAGTATTTCTCCTTGTTGCGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-262s21c1
Sequence:CCGGCTGAAGATACAAGAGAGGGATCTCGAGATCCCTCTCTTGTATCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-535s21c1
Sequence:CCGGAGAGAGTTTCTGCATTACAAACTCGAGTTTGTAATGCAGAAACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013587
VALIDATED
LRPAP1 MISSION shRNA Lentiviral Transduction Particles
low density lipoprotein receptor-related protein associated protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126039    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-1213s1c1
Sequence:CCGGCCCTTGAAATACCAAGCTGATCTCGAGATCAGCTTGGTATTTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-966s1c1
Sequence:CCGGCAGCCGCAACAAGGAGAAATACTCGAGTATTTCTCCTTGTTGCGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-262s1c1
Sequence:CCGGCTGAAGATACAAGAGAGGGATCTCGAGATCCCTCTCTTGTATCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-535s1c1
Sequence:CCGGAGAGAGTTTCTGCATTACAAACTCGAGTTTGTAATGCAGAAACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013587.2-111s1c1
Sequence:CCGGCGGCAAGTACTCGCGAGAGAACTCGAGTTCTCTCGCGAGTACTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013587.2-1213s21c1
Sequence:CCGGCCCTTGAAATACCAAGCTGATCTCGAGATCAGCTTGGTATTTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-111s21c1
Sequence:CCGGCGGCAAGTACTCGCGAGAGAACTCGAGTTCTCTCGCGAGTACTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-966s21c1
Sequence:CCGGCAGCCGCAACAAGGAGAAATACTCGAGTATTTCTCCTTGTTGCGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-262s21c1
Sequence:CCGGCTGAAGATACAAGAGAGGGATCTCGAGATCCCTCTCTTGTATCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013587.2-535s21c1
Sequence:CCGGAGAGAGTTTCTGCATTACAAACTCGAGTTTGTAATGCAGAAACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)