EMAIL THIS PAGE TO A FRIEND

LRPPRC

leucine-rich pentatricopeptide repeat containing

53 Gene Product Result for
Synonyms: CLONE-23970 GP130 LRP130 LSFC
Gene ID:
Human(10128) Summary: This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
Mouse(72416) leucine-rich PPR-motif containing
Rat(313867) leucine-rich pentatricopeptide repeat containing
naked mole-rat(101724140) leucine-rich pentatricopeptide repeat containing
domestic guinea pig(100718963) leucine-rich pentatricopeptide repeat containing
sheep(101113138) leucine-rich pentatricopeptide repeat containing
Zebrafish(557195) leucine-rich PPR-motif containing
domestic cat(101099542) leucine-rich pentatricopeptide repeat containing
cow(509995) leucine-rich pentatricopeptide repeat containing
Horse(100069041) leucine-rich pentatricopeptide repeat containing
dog(474572) leucine-rich pentatricopeptide repeat containing
chicken(421403) leucine-rich pentatricopeptide repeat containing
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133259 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028233 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028233 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028233 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133259 Rosetta Predictions human pricing
NM_001008519 Rosetta Predictions rat pricing
NM_028233 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066017 predicted 741
2 SASI_Hs01_00066018 predicted 1463
3 SASI_Hs01_00066019 predicted 477
4 SASI_Hs01_00066020 predicted 325
5 SASI_Hs01_00066021 predicted 1665
6 SASI_Hs01_00066022 predicted 2100
7 SASI_Hs01_00066023 predicted 945
8 SASI_Hs01_00066024 predicted 833
9 SASI_Hs01_00066025 predicted 1354
10 SASI_Hs01_00066026 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114818 predicted 3144
2 SASI_Rn01_00114819 predicted 253
3 SASI_Rn01_00114820 predicted 803
4 SASI_Rn01_00114821 predicted 1895
5 SASI_Rn01_00114822 predicted 2376
6 SASI_Rn01_00114824 predicted 2961
7 SASI_Rn02_00199201 predicted 2783
8 SASI_Rn02_00199202 predicted 1950
9 SASI_Rn01_00114826 predicted 1967
10 SASI_Rn01_00114827 predicted 922
11 SASI_Rn01_00114823 predicted 2752
12 SASI_Rn01_00114825 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333565 predicted 3005
2 SASI_Mm01_00031417 predicted 1759
3 SASI_Mm01_00031418 predicted 2795
4 SASI_Mm01_00031419 predicted 4200
5 SASI_Mm01_00031420 predicted 2639
6 SASI_Mm01_00031421 predicted 2482
7 SASI_Mm02_00333566 predicted 966
8 SASI_Mm01_00031423 predicted 2511
9 SASI_Mm02_00333567 predicted 3057
10 SASI_Mm01_00031424 predicted 535
11 SASI_Mm01_00031422 predicted 3547
12 SASI_Mm01_00031425 predicted 2723
13 SASI_Mm01_00031426 predicted 2964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133259
VALIDATED
LRPPRC MISSION shRNA Bacterial Glycerol Stock
leucine-rich pentatricopeptide repeat containing
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133259.3-3395s21c1
Sequence:GTACCGGACGCAAGTTAGGCGGGATTATCTCGAGATAATCCCGCCTAACTTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-1441s21c1
Sequence:CCGGCCTCAAAGGAATGCAAGAATTCTCGAGAATTCTTGCATTCCTTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-2443s21c1
Sequence:CCGGCGCAGCTTTAAGAGGTGAAATCTCGAGATTTCACCTCTTAAAGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-953s21c1
Sequence:CCGGCACCTTATGGACCGTGATTTACTCGAGTAAATCACGGTCCATAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-4383s21c1
Sequence:CCGGGACCATAACTCTGTGCACTTGCTCGAGCAAGTGCACAGAGTTATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-539s21c1
Sequence:CCGGGATGTGAGTCACTATAATGCTCTCGAGAGCATTATAGTGACTCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133259.2-4626s1c1
Sequence:CCGGCCGTGAACTTTCTAACGCATACTCGAGTATGCGTTAGAAAGTTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.2-2443s1c1
Sequence:CCGGCGCAGCTTTAAGAGGTGAAATCTCGAGATTTCACCTCTTAAAGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_133259.2-1441s1c1
Sequence:CCGGCCTCAAAGGAATGCAAGAATTCTCGAGAATTCTTGCATTCCTTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.2-868s1c1
Sequence:CCGGCCTCGCATTATTGAATGCATACTCGAGTATGCATTCAATAATGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.2-3384s1c1
Sequence:CCGGGCCTCATCATAACGCAAGTTACTCGAGTAACTTGCGTTATGATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.x-163s1c1
Sequence:CCGGATGTGAGTCACTATAATGCTCTCGAGAGCATTATAGTGACTCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.x-4007s1c1
Sequence:CCGGACCATAACTCTGTGCACTTGCTCGAGCAAGTGCACAGAGTTATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133259
VALIDATED
LRPPRC MISSION shRNA shRNA Plasmid DNA
leucine-rich pentatricopeptide repeat containing
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133259.3-3395s21c1
Sequence:GTACCGGACGCAAGTTAGGCGGGATTATCTCGAGATAATCCCGCCTAACTTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-1441s21c1
Sequence:CCGGCCTCAAAGGAATGCAAGAATTCTCGAGAATTCTTGCATTCCTTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-2443s21c1
Sequence:CCGGCGCAGCTTTAAGAGGTGAAATCTCGAGATTTCACCTCTTAAAGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-953s21c1
Sequence:CCGGCACCTTATGGACCGTGATTTACTCGAGTAAATCACGGTCCATAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-4383s21c1
Sequence:CCGGGACCATAACTCTGTGCACTTGCTCGAGCAAGTGCACAGAGTTATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-539s21c1
Sequence:CCGGGATGTGAGTCACTATAATGCTCTCGAGAGCATTATAGTGACTCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133259.2-4626s1c1
Sequence:CCGGCCGTGAACTTTCTAACGCATACTCGAGTATGCGTTAGAAAGTTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.2-2443s1c1
Sequence:CCGGCGCAGCTTTAAGAGGTGAAATCTCGAGATTTCACCTCTTAAAGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_133259.2-1441s1c1
Sequence:CCGGCCTCAAAGGAATGCAAGAATTCTCGAGAATTCTTGCATTCCTTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.2-868s1c1
Sequence:CCGGCCTCGCATTATTGAATGCATACTCGAGTATGCATTCAATAATGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.2-3384s1c1
Sequence:CCGGGCCTCATCATAACGCAAGTTACTCGAGTAACTTGCGTTATGATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.x-163s1c1
Sequence:CCGGATGTGAGTCACTATAATGCTCTCGAGAGCATTATAGTGACTCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.x-4007s1c1
Sequence:CCGGACCATAACTCTGTGCACTTGCTCGAGCAAGTGCACAGAGTTATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133259
VALIDATED
LRPPRC MISSION shRNA Lentiviral Transduction Particles
leucine-rich pentatricopeptide repeat containing
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133259.3-3395s21c1
Sequence:GTACCGGACGCAAGTTAGGCGGGATTATCTCGAGATAATCCCGCCTAACTTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-1441s21c1
Sequence:CCGGCCTCAAAGGAATGCAAGAATTCTCGAGAATTCTTGCATTCCTTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-2443s21c1
Sequence:CCGGCGCAGCTTTAAGAGGTGAAATCTCGAGATTTCACCTCTTAAAGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-953s21c1
Sequence:CCGGCACCTTATGGACCGTGATTTACTCGAGTAAATCACGGTCCATAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295839    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-4383s21c1
Sequence:CCGGGACCATAACTCTGTGCACTTGCTCGAGCAAGTGCACAGAGTTATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_133259.3-539s21c1
Sequence:CCGGGATGTGAGTCACTATAATGCTCTCGAGAGCATTATAGTGACTCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133259.2-4626s1c1
Sequence:CCGGCCGTGAACTTTCTAACGCATACTCGAGTATGCGTTAGAAAGTTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.2-2443s1c1
Sequence:CCGGCGCAGCTTTAAGAGGTGAAATCTCGAGATTTCACCTCTTAAAGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_133259.2-1441s1c1
Sequence:CCGGCCTCAAAGGAATGCAAGAATTCTCGAGAATTCTTGCATTCCTTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.2-868s1c1
Sequence:CCGGCCTCGCATTATTGAATGCATACTCGAGTATGCATTCAATAATGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.2-3384s1c1
Sequence:CCGGGCCTCATCATAACGCAAGTTACTCGAGTAACTTGCGTTATGATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.x-163s1c1
Sequence:CCGGATGTGAGTCACTATAATGCTCTCGAGAGCATTATAGTGACTCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133259.x-4007s1c1
Sequence:CCGGACCATAACTCTGTGCACTTGCTCGAGCAAGTGCACAGAGTTATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028233
VALIDATED
LRPPRC MISSION shRNA Bacterial Glycerol Stock
leucine-rich pentatricopeptide repeat containing
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-3823s21c1
Sequence:CCGGGCCCAGATGAAGAATAATAAACTCGAGTTTATTATTCTTCATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-2458s21c1
Sequence:CCGGGCGTGGAACTTGAAACAAGAACTCGAGTTCTTGTTTCAAGTTCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-1777s21c1
Sequence:CCGGGCAAGTAGTACCTTTGCTCAACTCGAGTTGAGCAAAGGTACTACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-2654s21c1
Sequence:CCGGGTGCAGCTTTAAGAGGTGAAACTCGAGTTTCACCTCTTAAAGCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.2-4197s1c1
Sequence:CCGGGATTCCTGAGTTACGTGATAACTCGAGTTATCACGTAACTCAGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.2-1920s1c1
Sequence:CCGGGTCGATGAACATAGATCTTTGCTCGAGCAAAGATCTATGTTCATCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.1-2817s1c1
Sequence:CCGGGAGACTGATTTGATCCAGAAACTCGAGTTTCTGGATCAAATCAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.1-788s1c1
Sequence:CCGGCCAACCAAATCGAGTAACATACTCGAGTATGTTACTCGATTTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-681s1c1
Sequence:CCGGGTCGTATATGATGTCAGTCATCTCGAGATGACTGACATCATATACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028233.1-3762s1c1
Sequence:CCGGGCCCAGATGAAGAATAATAAACTCGAGTTTATTATTCTTCATCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-1716s1c1
Sequence:CCGGGCAAGTAGTACCTTTGCTCAACTCGAGTTGAGCAAAGGTACTACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-2593s1c1
Sequence:CCGGGTGCAGCTTTAAGAGGTGAAACTCGAGTTTCACCTCTTAAAGCTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-2397s1c1
Sequence:CCGGGCGTGGAACTTGAAACAAGAACTCGAGTTCTTGTTTCAAGTTCCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028233
VALIDATED
LRPPRC MISSION shRNA shRNA Plasmid DNA
leucine-rich pentatricopeptide repeat containing
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-3823s21c1
Sequence:CCGGGCCCAGATGAAGAATAATAAACTCGAGTTTATTATTCTTCATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-2458s21c1
Sequence:CCGGGCGTGGAACTTGAAACAAGAACTCGAGTTCTTGTTTCAAGTTCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-1777s21c1
Sequence:CCGGGCAAGTAGTACCTTTGCTCAACTCGAGTTGAGCAAAGGTACTACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-2654s21c1
Sequence:CCGGGTGCAGCTTTAAGAGGTGAAACTCGAGTTTCACCTCTTAAAGCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.2-4197s1c1
Sequence:CCGGGATTCCTGAGTTACGTGATAACTCGAGTTATCACGTAACTCAGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.2-1920s1c1
Sequence:CCGGGTCGATGAACATAGATCTTTGCTCGAGCAAAGATCTATGTTCATCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.1-2817s1c1
Sequence:CCGGGAGACTGATTTGATCCAGAAACTCGAGTTTCTGGATCAAATCAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.1-788s1c1
Sequence:CCGGCCAACCAAATCGAGTAACATACTCGAGTATGTTACTCGATTTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-681s1c1
Sequence:CCGGGTCGTATATGATGTCAGTCATCTCGAGATGACTGACATCATATACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028233.1-3762s1c1
Sequence:CCGGGCCCAGATGAAGAATAATAAACTCGAGTTTATTATTCTTCATCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-1716s1c1
Sequence:CCGGGCAAGTAGTACCTTTGCTCAACTCGAGTTGAGCAAAGGTACTACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-2593s1c1
Sequence:CCGGGTGCAGCTTTAAGAGGTGAAACTCGAGTTTCACCTCTTAAAGCTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-2397s1c1
Sequence:CCGGGCGTGGAACTTGAAACAAGAACTCGAGTTCTTGTTTCAAGTTCCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028233
VALIDATED
LRPPRC MISSION shRNA Lentiviral Transduction Particles
leucine-rich pentatricopeptide repeat containing
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-3823s21c1
Sequence:CCGGGCCCAGATGAAGAATAATAAACTCGAGTTTATTATTCTTCATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-2458s21c1
Sequence:CCGGGCGTGGAACTTGAAACAAGAACTCGAGTTCTTGTTTCAAGTTCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-1777s21c1
Sequence:CCGGGCAAGTAGTACCTTTGCTCAACTCGAGTTGAGCAAAGGTACTACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028233.2-2654s21c1
Sequence:CCGGGTGCAGCTTTAAGAGGTGAAACTCGAGTTTCACCTCTTAAAGCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.2-4197s1c1
Sequence:CCGGGATTCCTGAGTTACGTGATAACTCGAGTTATCACGTAACTCAGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.2-1920s1c1
Sequence:CCGGGTCGATGAACATAGATCTTTGCTCGAGCAAAGATCTATGTTCATCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.1-2817s1c1
Sequence:CCGGGAGACTGATTTGATCCAGAAACTCGAGTTTCTGGATCAAATCAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028233.1-788s1c1
Sequence:CCGGCCAACCAAATCGAGTAACATACTCGAGTATGTTACTCGATTTGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-681s1c1
Sequence:CCGGGTCGTATATGATGTCAGTCATCTCGAGATGACTGACATCATATACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028233.1-3762s1c1
Sequence:CCGGGCCCAGATGAAGAATAATAAACTCGAGTTTATTATTCTTCATCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-1716s1c1
Sequence:CCGGGCAAGTAGTACCTTTGCTCAACTCGAGTTGAGCAAAGGTACTACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-2593s1c1
Sequence:CCGGGTGCAGCTTTAAGAGGTGAAACTCGAGTTTCACCTCTTAAAGCTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028233.1-2397s1c1
Sequence:CCGGGCGTGGAACTTGAAACAAGAACTCGAGTTCTTGTTTCAAGTTCCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)