EMAIL THIS PAGE TO A FRIEND

LRR1

leucine rich repeat protein 1

158 Gene Product Result for
Synonyms: 4-1BBLRR LRR-1 PPIL5
UniProtKB ID: Q96L50, A5D6X3, B4DDE0, Q52M24, Q86SZ1, Q8N6H9
Gene ID:
Human(122769) Summary: The protein encoded by this gene contains a leucine-rich repeat (LRR). It specifically interacts with TNFRSF9/4-1BB, a member of the tumor necrosis factor receptor (TNFR) superfamily. Overexpression of this gene suppresses the activation of NF-kappa B induced by TNFRSF9 or TNF receptor-associated factor 2 (TRAF2), which suggests that this protein is a negative regulator of TNFRSF9-mediated signaling cascades. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]
Mouse(69706) leucine rich repeat protein 1
Rat(685860) leucine rich repeat protein 1
Thale Cress(831521) leucine-rich repeat protein 1
cow(790210) leucine rich repeat protein 1
domestic cat(101091630) leucine rich repeat protein 1
dog(490676) leucine rich repeat protein 1
chicken(423565) leucine rich repeat protein 1
sheep(101119991) leucine rich repeat protein 1
domestic guinea pig(100719517) leucine rich repeat protein 1
naked mole-rat(101708337) leucine rich repeat protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152329 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074751 MISSION® esiRNA esiRNA human PPIL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152329 Rosetta Predictions human pricing
NM_203466 Rosetta Predictions human pricing
NM_203467 Rosetta Predictions human pricing
NM_001109483 Rosetta Predictions rat pricing
NM_001081406 Rosetta Predictions mouse pricing
XM_979324 Rosetta Predictions mouse pricing
XM_979374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160665 predicted 328
2 SASI_Hs01_00160666 predicted 347
3 SASI_Hs01_00160667 predicted 330
4 SASI_Hs01_00160668 predicted 1202
5 SASI_Hs01_00160669 predicted 1427
6 SASI_Hs02_00365926 predicted 749
7 SASI_Hs01_00160671 predicted 946
8 SASI_Hs01_00160672 predicted 1094
9 SASI_Hs01_00160673 predicted 825
10 SASI_Hs01_00160674 predicted 1114
11 SASI_Hs01_00160670 predicted 1650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073722 predicted 332
2 SASI_Hs01_00073723 predicted 352
3 SASI_Hs01_00073724 predicted 337
4 SASI_Hs01_00073725 predicted 777
5 SASI_Hs01_00073726 predicted 992
6 SASI_Hs01_00073727 predicted 507
7 SASI_Hs01_00073728 predicted 1030
8 SASI_Hs01_00073729 predicted 841
9 SASI_Hs01_00073730 predicted 851
10 SASI_Hs01_00073731 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010420 predicted 327
2 SASI_Hs01_00010421 predicted 347
3 SASI_Hs01_00010422 predicted 326
4 SASI_Hs01_00010423 predicted 710
5 SASI_Hs01_00010425 predicted 645
6 SASI_Hs02_00373400 predicted 686
7 SASI_Hs01_00010428 predicted 703
8 SASI_Hs02_00373401 predicted 967
9 SASI_Hs01_00010429 predicted 576
10 SASI_Hs02_00373402 predicted 517
11 SASI_Hs01_00010424 predicted 925
12 SASI_Hs01_00010426 predicted 963
13 SASI_Hs01_00010427 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248839 predicted 514
2 SASI_Rn02_00248840 predicted 866
3 SASI_Rn02_00248841 predicted 382
4 SASI_Rn02_00248842 predicted 1003
5 SASI_Rn02_00248843 predicted 897
6 SASI_Rn02_00248844 predicted 796
7 SASI_Rn02_00248845 predicted 552
8 SASI_Rn02_00248846 predicted 980
9 SASI_Rn02_00248847 predicted 500
10 SASI_Rn02_00248848 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298071 predicted 1038
2 SASI_Mm02_00298072 predicted 1074
3 SASI_Mm02_00298073 predicted 394
4 SASI_Mm02_00298074 predicted 509
5 SASI_Mm02_00298075 predicted 1014
6 SASI_Mm02_00298076 predicted 405
7 SASI_Mm02_00298077 predicted 1012
8 SASI_Mm02_00298078 predicted 797
9 SASI_Mm02_00298079 predicted 895
10 SASI_Mm02_00298080 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219125 predicted 322
2 SASI_Mm01_00219126 predicted 262
3 SASI_Mm01_00219127 predicted 235
4 SASI_Mm01_00219128 predicted 509
5 SASI_Mm01_00219129 predicted 315
6 SASI_Mm01_00219130 predicted 234
7 SASI_Mm01_00219131 predicted 447
8 SASI_Mm01_00219132 predicted 356
9 SASI_Mm01_00219133 predicted 459
10 SASI_Mm01_00219134 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220276 predicted 1051
2 SASI_Mm01_00220277 predicted 1077
3 SASI_Mm01_00220278 predicted 401
4 SASI_Mm01_00220279 predicted 508
5 SASI_Mm01_00220280 predicted 407
6 SASI_Mm01_00220281 predicted 1011
7 SASI_Mm01_00220282 predicted 801
8 SASI_Mm01_00220283 predicted 902
9 SASI_Mm01_00220284 predicted 574
10 SASI_Mm01_00220285 predicted 671
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152329
VALIDATED
LRR1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat protein 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152329.3-1367s1c1
Sequence:CCGGGCCAAGATTTGGATACCGCAACTCGAGTTGCGGTATCCAAATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152329.3-1469s1c1
Sequence:CCGGCTGTGGTCTTAGTAGATAATTCTCGAGAATTATCTACTAAGACCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152329.3-788s1c1
Sequence:CCGGCCTTGGAACATCTTCAGACTTCTCGAGAAGTCTGAAGATGTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152329.3-1208s1c1
Sequence:CCGGCCCTTGAATACTTGGATCTTTCTCGAGAAAGATCCAAGTATTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152329.3-501s1c1
Sequence:CCGGCTATGAGCTAAGGGAGAACATCTCGAGATGTTCTCCCTTAGCTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-523s21c1
Sequence:CCGGGAGCAATTCTTCACCAAATTTCTCGAGAAATTTGGTGAAGAATTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-555s21c1
Sequence:CCGGGAAAGCCACTGTTCGGTTAAACTCGAGTTTAACCGAACAGTGGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-1588s21c1
Sequence:CCGGGAAATTTCAATAACAGATCAGCTCGAGCTGATCTGTTATTGAAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-1494s21c1
Sequence:CCGGTGGTACTGAAGCACCTATTATCTCGAGATAATAGGTGCTTCAGTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-872s21c1
Sequence:CCGGACTTGAGTCACAACCATATAACTCGAGTTATATGGTTGTGACTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-586s21c1
Sequence:CCGGGTGGATATCTGTCTAAGTAAGCTCGAGCTTACTTAGACAGATATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152329.3-1300s21c1
Sequence:CCGGTCTTCTGCACGAACCATATTACTCGAGTAATATGGTTCGTGCAGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-1152s21c1
Sequence:CCGGTTTGTCAGCAGCTCGAAATAACTCGAGTTATTTCGAGCTGCTGACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152329
VALIDATED
LRR1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat protein 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152329.3-1367s1c1
Sequence:CCGGGCCAAGATTTGGATACCGCAACTCGAGTTGCGGTATCCAAATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152329.3-1469s1c1
Sequence:CCGGCTGTGGTCTTAGTAGATAATTCTCGAGAATTATCTACTAAGACCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152329.3-788s1c1
Sequence:CCGGCCTTGGAACATCTTCAGACTTCTCGAGAAGTCTGAAGATGTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152329.3-1208s1c1
Sequence:CCGGCCCTTGAATACTTGGATCTTTCTCGAGAAAGATCCAAGTATTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152329.3-501s1c1
Sequence:CCGGCTATGAGCTAAGGGAGAACATCTCGAGATGTTCTCCCTTAGCTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-523s21c1
Sequence:CCGGGAGCAATTCTTCACCAAATTTCTCGAGAAATTTGGTGAAGAATTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-555s21c1
Sequence:CCGGGAAAGCCACTGTTCGGTTAAACTCGAGTTTAACCGAACAGTGGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-1588s21c1
Sequence:CCGGGAAATTTCAATAACAGATCAGCTCGAGCTGATCTGTTATTGAAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-1494s21c1
Sequence:CCGGTGGTACTGAAGCACCTATTATCTCGAGATAATAGGTGCTTCAGTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-872s21c1
Sequence:CCGGACTTGAGTCACAACCATATAACTCGAGTTATATGGTTGTGACTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-586s21c1
Sequence:CCGGGTGGATATCTGTCTAAGTAAGCTCGAGCTTACTTAGACAGATATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152329.3-1300s21c1
Sequence:CCGGTCTTCTGCACGAACCATATTACTCGAGTAATATGGTTCGTGCAGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-1152s21c1
Sequence:CCGGTTTGTCAGCAGCTCGAAATAACTCGAGTTATTTCGAGCTGCTGACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152329
VALIDATED
LRR1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat protein 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152329.3-1367s1c1
Sequence:CCGGGCCAAGATTTGGATACCGCAACTCGAGTTGCGGTATCCAAATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152329.3-1469s1c1
Sequence:CCGGCTGTGGTCTTAGTAGATAATTCTCGAGAATTATCTACTAAGACCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152329.3-788s1c1
Sequence:CCGGCCTTGGAACATCTTCAGACTTCTCGAGAAGTCTGAAGATGTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152329.3-1208s1c1
Sequence:CCGGCCCTTGAATACTTGGATCTTTCTCGAGAAAGATCCAAGTATTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152329.3-501s1c1
Sequence:CCGGCTATGAGCTAAGGGAGAACATCTCGAGATGTTCTCCCTTAGCTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-523s21c1
Sequence:CCGGGAGCAATTCTTCACCAAATTTCTCGAGAAATTTGGTGAAGAATTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-555s21c1
Sequence:CCGGGAAAGCCACTGTTCGGTTAAACTCGAGTTTAACCGAACAGTGGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-1588s21c1
Sequence:CCGGGAAATTTCAATAACAGATCAGCTCGAGCTGATCTGTTATTGAAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-1494s21c1
Sequence:CCGGTGGTACTGAAGCACCTATTATCTCGAGATAATAGGTGCTTCAGTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-872s21c1
Sequence:CCGGACTTGAGTCACAACCATATAACTCGAGTTATATGGTTGTGACTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-586s21c1
Sequence:CCGGGTGGATATCTGTCTAAGTAAGCTCGAGCTTACTTAGACAGATATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152329.3-1300s21c1
Sequence:CCGGTCTTCTGCACGAACCATATTACTCGAGTAATATGGTTCGTGCAGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152329.3-1152s21c1
Sequence:CCGGTTTGTCAGCAGCTCGAAATAACTCGAGTTATTTCGAGCTGCTGACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081406
LRR1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000250065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081406.1-992s21c1
Sequence:CCGGCAGAAGTCATTCCAATTATAACTCGAGTTATAATTGGAATGACTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081406.1-669s21c1
Sequence:CCGGCCTTCAAGAGCTTAACCTTAACTCGAGTTAAGGTTAAGCTCTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081406.1-809s21c1
Sequence:CCGGTCCGGGAACTTACTAACTTAACTCGAGTTAAGTTAGTAAGTTCCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081406.1-1331s21c1
Sequence:CCGGGTTTCTAGATGTATATCAGTTCTCGAGAACTGATATACATCTAGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081406
LRR1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000250065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081406.1-992s21c1
Sequence:CCGGCAGAAGTCATTCCAATTATAACTCGAGTTATAATTGGAATGACTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081406.1-669s21c1
Sequence:CCGGCCTTCAAGAGCTTAACCTTAACTCGAGTTAAGGTTAAGCTCTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081406.1-809s21c1
Sequence:CCGGTCCGGGAACTTACTAACTTAACTCGAGTTAAGTTAGTAAGTTCCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081406.1-1331s21c1
Sequence:CCGGGTTTCTAGATGTATATCAGTTCTCGAGAACTGATATACATCTAGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081406
LRR1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000250065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081406.1-992s21c1
Sequence:CCGGCAGAAGTCATTCCAATTATAACTCGAGTTATAATTGGAATGACTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081406.1-669s21c1
Sequence:CCGGCCTTCAAGAGCTTAACCTTAACTCGAGTTAAGGTTAAGCTCTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081406.1-809s21c1
Sequence:CCGGTCCGGGAACTTACTAACTTAACTCGAGTTAAGTTAGTAAGTTCCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081406.1-1331s21c1
Sequence:CCGGGTTTCTAGATGTATATCAGTTCTCGAGAACTGATATACATCTAGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)