EMAIL THIS PAGE TO A FRIEND

LRRC10

leucine rich repeat containing 10

48 Gene Product Result for
Synonyms: HRLRRP LRRC10A
UniProtKB ID: Q5BKY1, Q6ZVY4
Gene ID:
Mouse(237560) leucine rich repeat containing 10
Rat(314848) leucine-rich repeat-containing 10
sheep(101101971) leucine rich repeat containing 10
domestic guinea pig(100725328) leucine rich repeat containing 10
naked mole-rat(101725769) leucine rich repeat containing 10
Zebrafish(798207) leucine rich repeat containing 10
cow(517750) leucine rich repeat containing 10
domestic cat(101099642) leucine rich repeat containing 10
dog(481157) leucine rich repeat containing 10
chicken(427865) leucine rich repeat containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201550 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135641 MISSION® esiRNA esiRNA human LRRC10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_201550 Rosetta Predictions human pricing
NM_001108096 Rosetta Predictions rat pricing
NM_146242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107052 predicted 1509
2 SASI_Hs01_00107053 predicted 1213
3 SASI_Hs01_00107054 predicted 1297
4 SASI_Hs01_00107055 predicted 853
5 SASI_Hs01_00107057 predicted 1077
6 SASI_Hs01_00107058 predicted 1363
7 SASI_Hs01_00107059 predicted 1524
8 SASI_Hs02_00373036 predicted 1123
9 SASI_Hs01_00107060 predicted 834
10 SASI_Hs02_00373037 predicted 1151
11 SASI_Hs01_00107056 predicted 1150
12 SASI_Hs01_00107061 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235314 predicted 914
2 SASI_Rn02_00235315 predicted 1095
3 SASI_Rn02_00235316 predicted 372
4 SASI_Rn02_00235317 predicted 938
5 SASI_Rn02_00235318 predicted 469
6 SASI_Rn02_00235319 predicted 995
7 SASI_Rn02_00235320 predicted 511
8 SASI_Rn02_00235321 predicted 591
9 SASI_Rn02_00235322 predicted 200
10 SASI_Rn02_00235323 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123312 predicted 590
2 SASI_Mm01_00123314 predicted 382
3 SASI_Mm01_00123315 predicted 1013
4 SASI_Mm02_00341964 predicted 378
5 SASI_Mm01_00123316 predicted 1011
6 SASI_Mm01_00123317 predicted 940
7 SASI_Mm01_00123318 predicted 501
8 SASI_Mm02_00341965 predicted 208
9 SASI_Mm01_00123319 predicted 1138
10 SASI_Mm01_00123320 predicted 486
11 SASI_Mm01_00123313 predicted 1126
12 SASI_Mm01_00123321 predicted 840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201550
LRRC10 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201550.2-571s1c1
Sequence:CCGGGATTTCAACAACTTCAAGGCTCTCGAGAGCCTTGAAGTTGTTGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201550.2-642s1c1
Sequence:CCGGCAACAACAAACTCTGCGACCTCTCGAGAGGTCGCAGAGTTTGTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201550.2-918s1c1
Sequence:CCGGCTGGAACAGCATCCGTTACTTCTCGAGAAGTAACGGATGCTGTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201550.2-2345s1c1
Sequence:CCGGCCACATTTCCAGAAGCATGTTCTCGAGAACATGCTTCTGGAAATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201550.2-1375s21c1
Sequence:CCGGTGACAATCCAGAGATCATAACCTCGAGGTTATGATCTCTGGATTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201550.2-1526s21c1
Sequence:CCGGGGTATTTGCCATAGAACTAAACTCGAGTTTAGTTCTATGGCAAATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201550.2-1585s21c1
Sequence:CCGGTTACTGTAAATGACCATAAACCTCGAGGTTTATGGTCATTTACAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201550.2-962s21c1
Sequence:CCGGGTCTGAAGCTGGTCATCTATGCTCGAGCATAGATGACCAGCTTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201550
LRRC10 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201550.2-571s1c1
Sequence:CCGGGATTTCAACAACTTCAAGGCTCTCGAGAGCCTTGAAGTTGTTGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201550.2-642s1c1
Sequence:CCGGCAACAACAAACTCTGCGACCTCTCGAGAGGTCGCAGAGTTTGTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201550.2-918s1c1
Sequence:CCGGCTGGAACAGCATCCGTTACTTCTCGAGAAGTAACGGATGCTGTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201550.2-2345s1c1
Sequence:CCGGCCACATTTCCAGAAGCATGTTCTCGAGAACATGCTTCTGGAAATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201550.2-1375s21c1
Sequence:CCGGTGACAATCCAGAGATCATAACCTCGAGGTTATGATCTCTGGATTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201550.2-1526s21c1
Sequence:CCGGGGTATTTGCCATAGAACTAAACTCGAGTTTAGTTCTATGGCAAATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201550.2-1585s21c1
Sequence:CCGGTTACTGTAAATGACCATAAACCTCGAGGTTTATGGTCATTTACAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201550.2-962s21c1
Sequence:CCGGGTCTGAAGCTGGTCATCTATGCTCGAGCATAGATGACCAGCTTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201550
LRRC10 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201550.2-571s1c1
Sequence:CCGGGATTTCAACAACTTCAAGGCTCTCGAGAGCCTTGAAGTTGTTGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201550.2-642s1c1
Sequence:CCGGCAACAACAAACTCTGCGACCTCTCGAGAGGTCGCAGAGTTTGTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201550.2-918s1c1
Sequence:CCGGCTGGAACAGCATCCGTTACTTCTCGAGAAGTAACGGATGCTGTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201550.2-2345s1c1
Sequence:CCGGCCACATTTCCAGAAGCATGTTCTCGAGAACATGCTTCTGGAAATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201550.2-1375s21c1
Sequence:CCGGTGACAATCCAGAGATCATAACCTCGAGGTTATGATCTCTGGATTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201550.2-1526s21c1
Sequence:CCGGGGTATTTGCCATAGAACTAAACTCGAGTTTAGTTCTATGGCAAATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201550.2-1585s21c1
Sequence:CCGGTTACTGTAAATGACCATAAACCTCGAGGTTTATGGTCATTTACAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201550.2-962s21c1
Sequence:CCGGGTCTGAAGCTGGTCATCTATGCTCGAGCATAGATGACCAGCTTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146242
LRRC10 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146242.1-310s1c1
Sequence:CCGGCCTTGGATTTCAACAACTTCACTCGAGTGAAGTTGTTGAAATCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146242.1-311s1c1
Sequence:CCGGCTTGGATTTCAACAACTTCAACTCGAGTTGAAGTTGTTGAAATCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146242.1-1223s1c1
Sequence:CCGGGAGTGCTTCAAAGACTGTATTCTCGAGAATACAGTCTTTGAAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146242.1-1227s1c1
Sequence:CCGGGCTTCAAAGACTGTATTTGTTCTCGAGAACAAATACAGTCTTTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146242.1-305s1c1
Sequence:CCGGCCTGGCCTTGGATTTCAACAACTCGAGTTGTTGAAATCCAAGGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146242
LRRC10 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146242.1-310s1c1
Sequence:CCGGCCTTGGATTTCAACAACTTCACTCGAGTGAAGTTGTTGAAATCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146242.1-311s1c1
Sequence:CCGGCTTGGATTTCAACAACTTCAACTCGAGTTGAAGTTGTTGAAATCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146242.1-1223s1c1
Sequence:CCGGGAGTGCTTCAAAGACTGTATTCTCGAGAATACAGTCTTTGAAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146242.1-1227s1c1
Sequence:CCGGGCTTCAAAGACTGTATTTGTTCTCGAGAACAAATACAGTCTTTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146242.1-305s1c1
Sequence:CCGGCCTGGCCTTGGATTTCAACAACTCGAGTTGTTGAAATCCAAGGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146242
LRRC10 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146242.1-310s1c1
Sequence:CCGGCCTTGGATTTCAACAACTTCACTCGAGTGAAGTTGTTGAAATCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146242.1-311s1c1
Sequence:CCGGCTTGGATTTCAACAACTTCAACTCGAGTTGAAGTTGTTGAAATCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146242.1-1223s1c1
Sequence:CCGGGAGTGCTTCAAAGACTGTATTCTCGAGAATACAGTCTTTGAAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146242.1-1227s1c1
Sequence:CCGGGCTTCAAAGACTGTATTTGTTCTCGAGAACAAATACAGTCTTTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146242.1-305s1c1
Sequence:CCGGCCTGGCCTTGGATTTCAACAACTCGAGTTGTTGAAATCCAAGGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)