EMAIL THIS PAGE TO A FRIEND

LRRC10B

leucine rich repeat containing 10B

82 Gene Product Result for
UniProtKB ID: A6NIK2
Gene ID:
Mouse(278795) leucine rich repeat containing 10B
Rat(309208) leucine rich repeat containing 10B
chicken(430454) leucine rich repeat containing 10B
domestic cat(101084572) leucine rich repeat containing 10B
cow(520410) leucine rich repeat containing 10B
dog(483797) leucine rich repeat containing 10B
naked mole-rat(101710968) leucine rich repeat containing 10B
domestic guinea pig(100725556) leucine rich repeat containing 10B
sheep(101109402) leucine rich repeat containing 10B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145077 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001111140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001111140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001111140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU228431 MISSION® esiRNA esiRNA targeting human LRRC10B human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715247 Rosetta Predictions human pricing
XM_372416 Rosetta Predictions human pricing
XM_938096 Rosetta Predictions human pricing
NM_001107577 Rosetta Predictions rat pricing
NM_001111140 Rosetta Predictions mouse pricing
XM_204937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00402425 predicted 277
2 SASI_Hs02_00402426 predicted 316
3 SASI_Hs02_00402427 predicted 260
4 SASI_Hs02_00402428 predicted 234
5 SASI_Hs02_00402429 predicted 216
6 SASI_Hs02_00402430 predicted 411
7 SASI_Hs02_00402431 predicted 449
8 SASI_Hs02_00402432 predicted 271
9 SASI_Hs02_00402433 predicted 311
10 SASI_Hs02_00402434 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254939 predicted 274
2 SASI_Hs01_00254940 predicted 313
3 SASI_Hs01_00254941 predicted 261
4 SASI_Hs01_00254946 predicted 234
5 SASI_Hs01_00254947 predicted 212
6 SASI_Hs02_00479420 predicted 414
7 SASI_Hs02_00479421 predicted 447
8 SASI_Hs02_00479422 predicted 268
9 SASI_Hs02_00479423 predicted 313
10 SASI_Hs02_00479424 predicted 315
11 SASI_Hs01_00254942 predicted 916
12 SASI_Hs01_00254943 predicted 922
13 SASI_Hs01_00254944 predicted 783
14 SASI_Hs01_00254945 predicted 1038
15 SASI_Hs01_00254948 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482894 predicted 274
2 SASI_Hs02_00482895 predicted 314
3 SASI_Hs02_00482896 predicted 263
4 SASI_Hs02_00482897 predicted 236
5 SASI_Hs02_00482898 predicted 213
6 SASI_Hs02_00482899 predicted 416
7 SASI_Hs02_00482900 predicted 451
8 SASI_Hs02_00482901 predicted 262
9 SASI_Hs02_00482902 predicted 311
10 SASI_Hs02_00482903 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230205 predicted 466
2 SASI_Rn02_00230206 predicted 971
3 SASI_Rn02_00230207 predicted 963
4 SASI_Rn02_00230208 predicted 957
5 SASI_Rn02_00230209 predicted 977
6 SASI_Rn02_00230210 predicted 961
7 SASI_Rn02_00230211 predicted 271
8 SASI_Rn02_00230212 predicted 921
9 SASI_Rn02_00230213 predicted 199
10 SASI_Rn02_00230214 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306502 predicted 339
2 SASI_Mm02_00306503 predicted 1011
3 SASI_Mm02_00306504 predicted 755
4 SASI_Mm02_00306505 predicted 1104
5 SASI_Mm02_00306506 predicted 505
6 SASI_Mm02_00306507 predicted 490
7 SASI_Mm02_00306508 predicted 629
8 SASI_Mm02_00306509 predicted 736
9 SASI_Mm02_00306510 predicted 881
10 SASI_Mm02_00306511 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_204937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249356 predicted 1202
2 SASI_Mm01_00249360 predicted 1087
3 SASI_Mm02_00425558 predicted 518
4 SASI_Mm01_00249361 predicted 937
5 SASI_Mm02_00425559 predicted 1291
6 SASI_Mm01_00249365 predicted 684
7 SASI_Mm02_00425560 predicted 676
8 SASI_Mm02_00425561 predicted 807
9 SASI_Mm02_00425562 predicted 913
10 SASI_Mm02_00425563 predicted 1057
11 SASI_Mm01_00249357 predicted 1330
12 SASI_Mm01_00249358 predicted 815
13 SASI_Mm01_00249359 predicted 850
14 SASI_Mm01_00249362 predicted 1335
15 SASI_Mm01_00249363 predicted 1102
16 SASI_Mm01_00249364 predicted 1289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145077
LRRC10B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 10B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1237s21c1
Sequence:CCGGCAGACACTCCTAGGTAGTAAGCTCGAGCTTACTACCTAGGAGTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145077.1-821s21c1
Sequence:CCGGGTCTTCTCCTACGACCACAACCTCGAGGTTGTGGTCGTAGGAGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1381s21c1
Sequence:CCGGTGAGGGCCACAGAATTGTCACCTCGAGGTGACAATTCTGTGGCCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1327s21c1
Sequence:CCGGCCGATGGAGCCACTGATAACACTCGAGTGTTATCAGTGGCTCCATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1250s21c1
Sequence:CCGGGTAGTAAGAGGACTGACTATACTCGAGTATAGTCAGTCCTCTTACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1394s21c1
Sequence:CCGGATTGTCACGTCTCCCTGAGTCCTCGAGGACTCAGGGAGACGTGACAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145077.1-552s21c1
Sequence:CCGGTCTGGATCGAGGGCAACTTCTCTCGAGAGAAGTTGCCCTCGATCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1176s21c1
Sequence:CCGGGGTCAATGGAACGGCTACTTTCTCGAGAAAGTAGCCGTTCCATTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1287s21c1
Sequence:CCGGGGCAATTGTCAGACCAAGAAGCTCGAGCTTCTTGGTCTGACAATTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145077
LRRC10B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 10B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1237s21c1
Sequence:CCGGCAGACACTCCTAGGTAGTAAGCTCGAGCTTACTACCTAGGAGTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145077.1-821s21c1
Sequence:CCGGGTCTTCTCCTACGACCACAACCTCGAGGTTGTGGTCGTAGGAGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1381s21c1
Sequence:CCGGTGAGGGCCACAGAATTGTCACCTCGAGGTGACAATTCTGTGGCCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1327s21c1
Sequence:CCGGCCGATGGAGCCACTGATAACACTCGAGTGTTATCAGTGGCTCCATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1250s21c1
Sequence:CCGGGTAGTAAGAGGACTGACTATACTCGAGTATAGTCAGTCCTCTTACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1394s21c1
Sequence:CCGGATTGTCACGTCTCCCTGAGTCCTCGAGGACTCAGGGAGACGTGACAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145077.1-552s21c1
Sequence:CCGGTCTGGATCGAGGGCAACTTCTCTCGAGAGAAGTTGCCCTCGATCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1176s21c1
Sequence:CCGGGGTCAATGGAACGGCTACTTTCTCGAGAAAGTAGCCGTTCCATTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1287s21c1
Sequence:CCGGGGCAATTGTCAGACCAAGAAGCTCGAGCTTCTTGGTCTGACAATTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145077
LRRC10B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 10B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1237s21c1
Sequence:CCGGCAGACACTCCTAGGTAGTAAGCTCGAGCTTACTACCTAGGAGTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145077.1-821s21c1
Sequence:CCGGGTCTTCTCCTACGACCACAACCTCGAGGTTGTGGTCGTAGGAGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1381s21c1
Sequence:CCGGTGAGGGCCACAGAATTGTCACCTCGAGGTGACAATTCTGTGGCCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1327s21c1
Sequence:CCGGCCGATGGAGCCACTGATAACACTCGAGTGTTATCAGTGGCTCCATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1250s21c1
Sequence:CCGGGTAGTAAGAGGACTGACTATACTCGAGTATAGTCAGTCCTCTTACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1394s21c1
Sequence:CCGGATTGTCACGTCTCCCTGAGTCCTCGAGGACTCAGGGAGACGTGACAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145077.1-552s21c1
Sequence:CCGGTCTGGATCGAGGGCAACTTCTCTCGAGAGAAGTTGCCCTCGATCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1176s21c1
Sequence:CCGGGGTCAATGGAACGGCTACTTTCTCGAGAAAGTAGCCGTTCCATTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441841    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145077.1-1287s21c1
Sequence:CCGGGGCAATTGTCAGACCAAGAAGCTCGAGCTTCTTGGTCTGACAATTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111140
LRRC10B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 10B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-485s21c1
Sequence:CCGGTCTGGATCGAAGGCAACTTCCCTCGAGGGAAGTTGCCTTCGATCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-342s21c1
Sequence:CCGGCATACTGGCGCTCGACTTCAACTCGAGTTGAAGTCGAGCGCCAGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-264s21c1
Sequence:CCGGCCGCTTGCAGAAGCTGTATGTCTCGAGACATACAGCTTCTGCAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-633s21c1
Sequence:CCGGCGGCAATCGCTTCGAAGAGTTCTCGAGAACTCTTCGAAGCGATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-911s21c1
Sequence:CCGGAGGAAGAAGACCTACTCATAGCTCGAGCTATGAGTAGGTCTTCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-1009s21c1
Sequence:CCGGTGAGCCTCTTCCCTGAGTGATCTCGAGATCACTCAGGGAAGAGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-982s21c1
Sequence:CCGGTTGGAAGCTCCTCCAGGATTGCTCGAGCAATCCTGGAGGAGCTTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111140
LRRC10B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 10B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-485s21c1
Sequence:CCGGTCTGGATCGAAGGCAACTTCCCTCGAGGGAAGTTGCCTTCGATCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-342s21c1
Sequence:CCGGCATACTGGCGCTCGACTTCAACTCGAGTTGAAGTCGAGCGCCAGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-264s21c1
Sequence:CCGGCCGCTTGCAGAAGCTGTATGTCTCGAGACATACAGCTTCTGCAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-633s21c1
Sequence:CCGGCGGCAATCGCTTCGAAGAGTTCTCGAGAACTCTTCGAAGCGATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-911s21c1
Sequence:CCGGAGGAAGAAGACCTACTCATAGCTCGAGCTATGAGTAGGTCTTCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-1009s21c1
Sequence:CCGGTGAGCCTCTTCCCTGAGTGATCTCGAGATCACTCAGGGAAGAGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-982s21c1
Sequence:CCGGTTGGAAGCTCCTCCAGGATTGCTCGAGCAATCCTGGAGGAGCTTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111140
LRRC10B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 10B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-485s21c1
Sequence:CCGGTCTGGATCGAAGGCAACTTCCCTCGAGGGAAGTTGCCTTCGATCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-342s21c1
Sequence:CCGGCATACTGGCGCTCGACTTCAACTCGAGTTGAAGTCGAGCGCCAGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-264s21c1
Sequence:CCGGCCGCTTGCAGAAGCTGTATGTCTCGAGACATACAGCTTCTGCAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-633s21c1
Sequence:CCGGCGGCAATCGCTTCGAAGAGTTCTCGAGAACTCTTCGAAGCGATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-911s21c1
Sequence:CCGGAGGAAGAAGACCTACTCATAGCTCGAGCTATGAGTAGGTCTTCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-1009s21c1
Sequence:CCGGTGAGCCTCTTCCCTGAGTGATCTCGAGATCACTCAGGGAAGAGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111140.1-982s21c1
Sequence:CCGGTTGGAAGCTCCTCCAGGATTGCTCGAGCAATCCTGGAGGAGCTTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)