EMAIL THIS PAGE TO A FRIEND

LRRC14

leucine rich repeat containing 14

132 Gene Product Result for
Synonyms: LRRC14A
UniProtKB ID: Q15048, A8K0A8, D3DWM8
Gene ID:
Human(9684) Summary: This gene encodes a leucine-rich repeat-containing protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(223664) leucine rich repeat containing 14
Rat(500900) leucine rich repeat containing 14
sheep(101106780) leucine rich repeat containing 14
domestic guinea pig(100716885) leucine rich repeat containing 14
domestic cat(101082212) leucine rich repeat containing 14
cow(539952) leucine rich repeat containing 14
Horse(100063224) leucine rich repeat containing 14
dog(482102) leucine rich repeat containing 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34712 Anti-LRRC14 antibody produced in rabbit affinity isolated antibody human, canine, bovine, horse, guinea pig, rat, mouse
western blot pricing
HPA021047 Anti-LRRC14 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014665 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014665 Rosetta Predictions human pricing
NM_001024354 Rosetta Predictions rat pricing
NM_145471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019602 predicted 1337
2 SASI_Hs01_00019603 predicted 510
3 SASI_Hs01_00019605 predicted 1292
4 SASI_Hs01_00019606 predicted 383
5 SASI_Hs01_00019607 predicted 659
6 SASI_Hs01_00019608 predicted 1869
7 SASI_Hs01_00019609 predicted 1262
8 SASI_Hs01_00019610 predicted 1941
9 SASI_Hs01_00019611 predicted 1261
10 SASI_Hs02_00346008 predicted 1939
11 SASI_Hs01_00019604 predicted 1881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088718 predicted 839
2 SASI_Rn01_00088719 predicted 805
3 SASI_Rn01_00088720 predicted 1362
4 SASI_Rn01_00088721 predicted 559
5 SASI_Rn01_00088722 predicted 695
6 SASI_Rn01_00088723 predicted 1532
7 SASI_Rn02_00202582 predicted 1679
8 SASI_Rn01_00088724 predicted 1561
9 SASI_Rn01_00088726 predicted 1195
10 SASI_Rn01_00088727 predicted 667
11 SASI_Rn01_00088725 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147244 predicted 1018
2 SASI_Mm01_00147245 predicted 859
3 SASI_Mm01_00147246 predicted 1014
4 SASI_Mm01_00147247 predicted 1896
5 SASI_Mm01_00147249 predicted 867
6 SASI_Mm01_00147250 predicted 1827
7 SASI_Mm01_00147251 predicted 1070
8 SASI_Mm01_00147252 predicted 1914
9 SASI_Mm01_00147253 predicted 1556
10 SASI_Mm02_00340873 predicted 852
11 SASI_Mm01_00147248 predicted 1038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014665
LRRC14 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014665.1-1870s21c1
Sequence:CCGCTCCATTGCCCTGCTCAGTTTGCTCGAGCAAACTGAGCAGGGCAATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014665.1-392s21c1
Sequence:CCGGTGAGAGCATGCAGGCTGTTATCTCGAGATAACAGCCTGCATGCTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-3819s1c1
Sequence:CCGGGCTCCTTAAGTCTTCCTGCAACTCGAGTTGCAGGAAGACTTAAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014665.1-1496s1c1
Sequence:CCGGCTCCATCAATGAGGAGAAGTTCTCGAGAACTTCTCCTCATTGATGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014665.1-516s1c1
Sequence:CCGGGATGATGGTGTGGAACAGGATCTCGAGATCCTGTTCCACACCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-4593s1c1
Sequence:CCGGGCAGGTGCAAGAAGGTGAAATCTCGAGATTTCACCTTCTTGCACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014665.1-1163s1c1
Sequence:CCGGGAAGTTGGACCTGAGTGGTAACTCGAGTTACCACTCAGGTCCAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165570    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-4428s1c1
Sequence:CCGGGCTGAAGTAAGGACAGCAGATCTCGAGATCTGCTGTCCTTACTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-3772s1c1
Sequence:CCGGCCTGCCTGTTACAGATCACTTCTCGAGAAGTGATCTGTAACAGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014665
LRRC14 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014665.1-1870s21c1
Sequence:CCGCTCCATTGCCCTGCTCAGTTTGCTCGAGCAAACTGAGCAGGGCAATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014665.1-392s21c1
Sequence:CCGGTGAGAGCATGCAGGCTGTTATCTCGAGATAACAGCCTGCATGCTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-3819s1c1
Sequence:CCGGGCTCCTTAAGTCTTCCTGCAACTCGAGTTGCAGGAAGACTTAAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014665.1-1496s1c1
Sequence:CCGGCTCCATCAATGAGGAGAAGTTCTCGAGAACTTCTCCTCATTGATGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014665.1-516s1c1
Sequence:CCGGGATGATGGTGTGGAACAGGATCTCGAGATCCTGTTCCACACCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-4593s1c1
Sequence:CCGGGCAGGTGCAAGAAGGTGAAATCTCGAGATTTCACCTTCTTGCACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014665.1-1163s1c1
Sequence:CCGGGAAGTTGGACCTGAGTGGTAACTCGAGTTACCACTCAGGTCCAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165570    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-4428s1c1
Sequence:CCGGGCTGAAGTAAGGACAGCAGATCTCGAGATCTGCTGTCCTTACTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-3772s1c1
Sequence:CCGGCCTGCCTGTTACAGATCACTTCTCGAGAAGTGATCTGTAACAGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014665
LRRC14 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014665.1-1870s21c1
Sequence:CCGCTCCATTGCCCTGCTCAGTTTGCTCGAGCAAACTGAGCAGGGCAATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014665.1-392s21c1
Sequence:CCGGTGAGAGCATGCAGGCTGTTATCTCGAGATAACAGCCTGCATGCTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-3819s1c1
Sequence:CCGGGCTCCTTAAGTCTTCCTGCAACTCGAGTTGCAGGAAGACTTAAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014665.1-1496s1c1
Sequence:CCGGCTCCATCAATGAGGAGAAGTTCTCGAGAACTTCTCCTCATTGATGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014665.1-516s1c1
Sequence:CCGGGATGATGGTGTGGAACAGGATCTCGAGATCCTGTTCCACACCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165888    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-4593s1c1
Sequence:CCGGGCAGGTGCAAGAAGGTGAAATCTCGAGATTTCACCTTCTTGCACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014665.1-1163s1c1
Sequence:CCGGGAAGTTGGACCTGAGTGGTAACTCGAGTTACCACTCAGGTCCAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165570    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-4428s1c1
Sequence:CCGGGCTGAAGTAAGGACAGCAGATCTCGAGATCTGCTGTCCTTACTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014665.1-3772s1c1
Sequence:CCGGCCTGCCTGTTACAGATCACTTCTCGAGAAGTGATCTGTAACAGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145471
VALIDATED
LRRC14 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-1803s21c1
Sequence:CCGGCCGGCTAGCTGCAGACTATTTCTCGAGAAATAGTCTGCAGCTAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-1052s21c1
Sequence:CCGGTGCGTGGCCTGTCTGTCATTACTCGAGTAATGACAGACAGGCCACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-852s21c1
Sequence:CCGGCCGAGTAGACCTTCGGGTAAACTCGAGTTTACCCGAAGGTCTACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145471.2-1844s21c1
Sequence:CCGGCGTAGTGAAGCCTGACACAAACTCGAGTTTGTGTCAGGCTTCACTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-1160s21c1
Sequence:CCGGAGGACAACTTTCGCTACTTTCCTCGAGGAAAGTAGCGAAAGTTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145471.1-1064s1c1
Sequence:CCGGCCTGTCTGTCATTATCCCACACTCGAGTGTGGGATAATGACAGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145471.1-1849s1c1
Sequence:CCGGCGTAGTGAAGCCTGACACAAACTCGAGTTTGTGTCAGGCTTCACTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145471.1-1567s1c1
Sequence:CCGGCTTTGTCTATGGCAGGACTTACTCGAGTAAGTCCTGCCATAGACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145471.1-461s1c1
Sequence:CCGGCAAGGTGGCTTTCATGGACAACTCGAGTTGTCCATGAAAGCCACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145471.1-1743s1c1
Sequence:CCGGGAGTTACACCAACTGCTGTTACTCGAGTAACAGCAGTTGGTGTAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145471
VALIDATED
LRRC14 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-1803s21c1
Sequence:CCGGCCGGCTAGCTGCAGACTATTTCTCGAGAAATAGTCTGCAGCTAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-1052s21c1
Sequence:CCGGTGCGTGGCCTGTCTGTCATTACTCGAGTAATGACAGACAGGCCACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-852s21c1
Sequence:CCGGCCGAGTAGACCTTCGGGTAAACTCGAGTTTACCCGAAGGTCTACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145471.2-1844s21c1
Sequence:CCGGCGTAGTGAAGCCTGACACAAACTCGAGTTTGTGTCAGGCTTCACTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-1160s21c1
Sequence:CCGGAGGACAACTTTCGCTACTTTCCTCGAGGAAAGTAGCGAAAGTTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145471.1-1064s1c1
Sequence:CCGGCCTGTCTGTCATTATCCCACACTCGAGTGTGGGATAATGACAGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145471.1-1849s1c1
Sequence:CCGGCGTAGTGAAGCCTGACACAAACTCGAGTTTGTGTCAGGCTTCACTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145471.1-1567s1c1
Sequence:CCGGCTTTGTCTATGGCAGGACTTACTCGAGTAAGTCCTGCCATAGACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145471.1-461s1c1
Sequence:CCGGCAAGGTGGCTTTCATGGACAACTCGAGTTGTCCATGAAAGCCACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145471.1-1743s1c1
Sequence:CCGGGAGTTACACCAACTGCTGTTACTCGAGTAACAGCAGTTGGTGTAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145471
VALIDATED
LRRC14 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-1803s21c1
Sequence:CCGGCCGGCTAGCTGCAGACTATTTCTCGAGAAATAGTCTGCAGCTAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-1052s21c1
Sequence:CCGGTGCGTGGCCTGTCTGTCATTACTCGAGTAATGACAGACAGGCCACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-852s21c1
Sequence:CCGGCCGAGTAGACCTTCGGGTAAACTCGAGTTTACCCGAAGGTCTACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145471.2-1844s21c1
Sequence:CCGGCGTAGTGAAGCCTGACACAAACTCGAGTTTGTGTCAGGCTTCACTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145471.2-1160s21c1
Sequence:CCGGAGGACAACTTTCGCTACTTTCCTCGAGGAAAGTAGCGAAAGTTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145471.1-1064s1c1
Sequence:CCGGCCTGTCTGTCATTATCCCACACTCGAGTGTGGGATAATGACAGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145471.1-1849s1c1
Sequence:CCGGCGTAGTGAAGCCTGACACAAACTCGAGTTTGTGTCAGGCTTCACTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145471.1-1567s1c1
Sequence:CCGGCTTTGTCTATGGCAGGACTTACTCGAGTAAGTCCTGCCATAGACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145471.1-461s1c1
Sequence:CCGGCAAGGTGGCTTTCATGGACAACTCGAGTTGTCCATGAAAGCCACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145471.1-1743s1c1
Sequence:CCGGGAGTTACACCAACTGCTGTTACTCGAGTAACAGCAGTTGGTGTAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)