EMAIL THIS PAGE TO A FRIEND

LRRC14B

leucine rich repeat containing 14B

54 Gene Product Result for
UniProtKB ID: A6NHZ5
Gene ID:
Mouse(432779) leucine rich repeat containing 14B
Rat(502225) leucine rich repeat containing 14B
chicken(428472) leucine rich repeat containing 14B
cow(100301203) leucine rich repeat containing 14B
Horse(100057551) leucine rich repeat containing 14B
domestic cat(101097379) leucine rich repeat containing 14B
dog(488075) leucine rich repeat containing 14B
domestic guinea pig(100716955) leucine rich repeat containing 14B
naked mole-rat(101696845) leucine rich repeat containing 14B
Domestic Rabbit(100358572) leucine rich repeat containing 14B
sheep(101108777) leucine rich repeat containing 14B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080478 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU153421 MISSION® esiRNA esiRNA targeting mouse Lrrc14b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080478 Rosetta Predictions human pricing
XM_371722 Rosetta Predictions human pricing
NM_001109333 Rosetta Predictions rat pricing
NM_001033042 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315226 predicted 962
2 SASI_Hs02_00315227 predicted 1038
3 SASI_Hs02_00315228 predicted 759
4 SASI_Hs02_00315229 predicted 507
5 SASI_Hs02_00315230 predicted 351
6 SASI_Hs02_00315231 predicted 1333
7 SASI_Hs02_00315232 predicted 1248
8 SASI_Hs02_00315233 predicted 1246
9 SASI_Hs02_00315234 predicted 508
10 SASI_Hs02_00315235 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299523 predicted 956
2 SASI_Hs01_00299524 predicted 1039
3 SASI_Hs01_00299525 predicted 767
4 SASI_Hs01_00299526 predicted 508
5 SASI_Hs01_00299527 predicted 352
6 SASI_Hs01_00299528 predicted 1329
7 SASI_Hs01_00299529 predicted 1241
8 SASI_Hs01_00299530 predicted 1245
9 SASI_Hs01_00299531 predicted 507
10 SASI_Hs01_00299532 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247394 predicted 929
2 SASI_Rn02_00247395 predicted 916
3 SASI_Rn02_00247396 predicted 829
4 SASI_Rn02_00247397 predicted 1063
5 SASI_Rn02_00247398 predicted 1378
6 SASI_Rn02_00247399 predicted 778
7 SASI_Rn02_00247400 predicted 997
8 SASI_Rn02_00247401 predicted 951
9 SASI_Rn02_00247402 predicted 1529
10 SASI_Rn02_00247403 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176058 predicted 1046
2 SASI_Mm01_00176059 predicted 945
3 SASI_Mm01_00176060 predicted 958
4 SASI_Mm01_00176061 predicted 1487
5 SASI_Mm01_00176062 predicted 1328
6 SASI_Mm01_00176063 predicted 875
7 SASI_Mm01_00176064 predicted 1335
8 SASI_Mm01_00176065 predicted 1572
9 SASI_Mm01_00176066 predicted 668
10 SASI_Mm01_00176067 predicted 1106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080478
LRRC14B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 14B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-1369s21c1
Sequence:CCGGCCAGCAGAAATACGACGAGATCTCGAGATCTCGTCGTATTTCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-515s21c1
Sequence:CCGGTTCGTCACTGAGGGCAACTTCCTCGAGGAAGTTGCCCTCAGTGACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-126s21c1
Sequence:CCGGTCTACCCACTCCTGTTCAAAGCTCGAGCTTTGAACAGGAGTGGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-1048s21c1
Sequence:CCGGACACAACCTGGTCAGCCTGTACTCGAGTACAGGCTGACCAGGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-1347s21c1
Sequence:CCGGAGCTGGCCATGTCCAAGTTCACTCGAGTGAACTTGGACATGGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080478
LRRC14B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 14B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-1369s21c1
Sequence:CCGGCCAGCAGAAATACGACGAGATCTCGAGATCTCGTCGTATTTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-515s21c1
Sequence:CCGGTTCGTCACTGAGGGCAACTTCCTCGAGGAAGTTGCCCTCAGTGACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-126s21c1
Sequence:CCGGTCTACCCACTCCTGTTCAAAGCTCGAGCTTTGAACAGGAGTGGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-1048s21c1
Sequence:CCGGACACAACCTGGTCAGCCTGTACTCGAGTACAGGCTGACCAGGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-1347s21c1
Sequence:CCGGAGCTGGCCATGTCCAAGTTCACTCGAGTGAACTTGGACATGGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080478
LRRC14B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 14B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-1369s21c1
Sequence:CCGGCCAGCAGAAATACGACGAGATCTCGAGATCTCGTCGTATTTCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-515s21c1
Sequence:CCGGTTCGTCACTGAGGGCAACTTCCTCGAGGAAGTTGCCCTCAGTGACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-126s21c1
Sequence:CCGGTCTACCCACTCCTGTTCAAAGCTCGAGCTTTGAACAGGAGTGGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-1048s21c1
Sequence:CCGGACACAACCTGGTCAGCCTGTACTCGAGTACAGGCTGACCAGGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080478.1-1347s21c1
Sequence:CCGGAGCTGGCCATGTCCAAGTTCACTCGAGTGAACTTGGACATGGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033042
LRRC14B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 14B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033042.1-99s1c1
Sequence:CCGGCAGGAGAACCTGGACAATATACTCGAGTATATTGTCCAGGTTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-1272s21c1
Sequence:CCGGCTCCCTAGGCTTCGCCATATTCTCGAGAATATGGCGAAGCCTAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033042.3-822s1c1
Sequence:CCGGGATCTTCTCCTTACCTCTATTCTCGAGAATAGAGGTAAGGAGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-960s21c1
Sequence:CCGGCTAGCCAACTGTGCCCTTAATCTCGAGATTAAGGGCACAGTTGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-99s21c1
Sequence:CCGGCAGGAGAACCTGGACAATATACTCGAGTATATTGTCCAGGTTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-823s21c1
Sequence:CCGGATCTTCTCCTTACCTCTATTGCTCGAGCAATAGAGGTAAGGAGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033042.3-1771s21c1
Sequence:CCGGGTTAGCACAGCAAGATCTTAACTCGAGTTAAGATCTTGCTGTGCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033042.1-1677s1c1
Sequence:CCGGCCACAAGATTTCCTCAGAGAACTCGAGTTCTCTGAGGAAATCTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033042
LRRC14B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 14B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033042.1-99s1c1
Sequence:CCGGCAGGAGAACCTGGACAATATACTCGAGTATATTGTCCAGGTTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-1272s21c1
Sequence:CCGGCTCCCTAGGCTTCGCCATATTCTCGAGAATATGGCGAAGCCTAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033042.3-822s1c1
Sequence:CCGGGATCTTCTCCTTACCTCTATTCTCGAGAATAGAGGTAAGGAGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-960s21c1
Sequence:CCGGCTAGCCAACTGTGCCCTTAATCTCGAGATTAAGGGCACAGTTGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-99s21c1
Sequence:CCGGCAGGAGAACCTGGACAATATACTCGAGTATATTGTCCAGGTTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-823s21c1
Sequence:CCGGATCTTCTCCTTACCTCTATTGCTCGAGCAATAGAGGTAAGGAGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033042.3-1771s21c1
Sequence:CCGGGTTAGCACAGCAAGATCTTAACTCGAGTTAAGATCTTGCTGTGCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033042.1-1677s1c1
Sequence:CCGGCCACAAGATTTCCTCAGAGAACTCGAGTTCTCTGAGGAAATCTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033042
LRRC14B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 14B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033042.1-99s1c1
Sequence:CCGGCAGGAGAACCTGGACAATATACTCGAGTATATTGTCCAGGTTCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-1272s21c1
Sequence:CCGGCTCCCTAGGCTTCGCCATATTCTCGAGAATATGGCGAAGCCTAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033042.3-822s1c1
Sequence:CCGGGATCTTCTCCTTACCTCTATTCTCGAGAATAGAGGTAAGGAGAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-960s21c1
Sequence:CCGGCTAGCCAACTGTGCCCTTAATCTCGAGATTAAGGGCACAGTTGGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-99s21c1
Sequence:CCGGCAGGAGAACCTGGACAATATACTCGAGTATATTGTCCAGGTTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033042.3-823s21c1
Sequence:CCGGATCTTCTCCTTACCTCTATTGCTCGAGCAATAGAGGTAAGGAGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033042.3-1771s21c1
Sequence:CCGGGTTAGCACAGCAAGATCTTAACTCGAGTTAAGATCTTGCTGTGCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200952    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033042.1-1677s1c1
Sequence:CCGGCCACAAGATTTCCTCAGAGAACTCGAGTTCTCTGAGGAAATCTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)