EMAIL THIS PAGE TO A FRIEND

LRRC15

leucine rich repeat containing 15

113 Gene Product Result for
Synonyms: LIB
UniProtKB ID: Q8TF66, Q495Q6, Q7RTN7
Gene ID:
Mouse(74488) leucine rich repeat containing 15
Rat(246296) leucine rich repeat containing 15
sheep(101103371) leucine rich repeat containing 15
Domestic Rabbit(100345007) leucine rich repeat containing 15
naked mole-rat(101696532) leucine rich repeat containing 15
domestic guinea pig(100734846) leucine rich repeat containing 15
Zebrafish(791200) leucine rich repeat containing 15
cow(100848949) leucine rich repeat containing 15
Horse(100069043) leucine rich repeat containing 15
chicken(768899) leucine rich repeat containing 15
dog(488041) leucine rich repeat containing 15
domestic cat(101090711) leucine rich repeat containing 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028973 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028973 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028973 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130830 Rosetta Predictions human pricing
NM_145083 Rosetta Predictions rat pricing
NM_028973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174662 predicted 1689
2 SASI_Hs01_00174663 predicted 950
3 SASI_Hs01_00174664 predicted 886
4 SASI_Hs01_00174665 predicted 1117
5 SASI_Hs01_00174666 predicted 1622
6 SASI_Hs02_00362851 predicted 539
7 SASI_Hs01_00174668 predicted 1144
8 SASI_Hs01_00174669 predicted 1640
9 SASI_Hs01_00174670 predicted 621
10 SASI_Hs02_00362852 predicted 460
11 SASI_Hs01_00174667 predicted 542
12 SASI_Hs01_00174671 predicted 1684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120315 predicted 1002
2 SASI_Rn01_00120317 predicted 1099
3 SASI_Rn01_00120318 predicted 426
4 SASI_Rn01_00120319 predicted 739
5 SASI_Rn01_00120320 predicted 823
6 SASI_Rn01_00120321 predicted 970
7 SASI_Rn01_00120322 predicted 550
8 SASI_Rn01_00120323 predicted 1398
9 SASI_Rn01_00120324 predicted 465
10 SASI_Rn02_00268657 predicted 1276
11 SASI_Rn01_00120316 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059200 predicted 1033
2 SASI_Mm01_00059201 predicted 533
3 SASI_Mm01_00059202 predicted 1466
4 SASI_Mm01_00059203 predicted 882
5 SASI_Mm01_00059204 predicted 501
6 SASI_Mm01_00059205 predicted 811
7 SASI_Mm01_00059206 predicted 457
8 SASI_Mm01_00059207 predicted 1509
9 SASI_Mm01_00059208 predicted 1340
10 SASI_Mm01_00059209 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130830
LRRC15 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 15
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130830.2-3382s1c1
Sequence:CCGGCGGAATCTAGTGTCTTTCTAACTCGAGTTAGAAAGACACTAGATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-1767s1c1
Sequence:CCGGGCCGCCATTGTAATTGGCATTCTCGAGAATGCCAATTACAATGGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130830.2-2002s1c1
Sequence:CCGGCCCTAGATAAAGGTGTGCCTACTCGAGTAGGCACACCTTTATCTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-1674s1c1
Sequence:CCGGCCTGTGGAAGACTACACTGATCTCGAGATCAGTGTAGTCTTCCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130830.2-959s1c1
Sequence:CCGGCCGTCTTACTCTCTTTGGGAACTCGAGTTCCCAAAGAGAGTAAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-1118s1c1
Sequence:CCGGCCGCAATCAGATCAGCTTCATCTCGAGATGAAGCTGATCTGATTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-671s1c1
Sequence:CCGGGAAGCTCAATCTGGGCAAGAACTCGAGTTCTTGCCCAGATTGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130830.2-1106s1c1
Sequence:CCGGCCTGATTCTTAGCCGCAATCACTCGAGTGATTGCGGCTAAGAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-887s1c1
Sequence:CCGGGAGACTCTACCTGTCCAACAACTCGAGTTGTTGGACAGGTAGAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130830.2-2502s1c1
Sequence:CCGGGCTATGAAAGAGAGAAGGAAACTCGAGTTTCCTTCTCTCTTTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130830.2-5675s1c1
Sequence:CCGGCCAGGTTTCTTCTTCTCTTAACTCGAGTTAAGAGAAGAAGAAACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130830
LRRC15 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 15
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130830.2-3382s1c1
Sequence:CCGGCGGAATCTAGTGTCTTTCTAACTCGAGTTAGAAAGACACTAGATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-1767s1c1
Sequence:CCGGGCCGCCATTGTAATTGGCATTCTCGAGAATGCCAATTACAATGGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130830.2-2002s1c1
Sequence:CCGGCCCTAGATAAAGGTGTGCCTACTCGAGTAGGCACACCTTTATCTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-1674s1c1
Sequence:CCGGCCTGTGGAAGACTACACTGATCTCGAGATCAGTGTAGTCTTCCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130830.2-959s1c1
Sequence:CCGGCCGTCTTACTCTCTTTGGGAACTCGAGTTCCCAAAGAGAGTAAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-1118s1c1
Sequence:CCGGCCGCAATCAGATCAGCTTCATCTCGAGATGAAGCTGATCTGATTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-671s1c1
Sequence:CCGGGAAGCTCAATCTGGGCAAGAACTCGAGTTCTTGCCCAGATTGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130830.2-1106s1c1
Sequence:CCGGCCTGATTCTTAGCCGCAATCACTCGAGTGATTGCGGCTAAGAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-887s1c1
Sequence:CCGGGAGACTCTACCTGTCCAACAACTCGAGTTGTTGGACAGGTAGAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130830.2-2502s1c1
Sequence:CCGGGCTATGAAAGAGAGAAGGAAACTCGAGTTTCCTTCTCTCTTTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130830.2-5675s1c1
Sequence:CCGGCCAGGTTTCTTCTTCTCTTAACTCGAGTTAAGAGAAGAAGAAACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130830
LRRC15 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 15
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130830.2-3382s1c1
Sequence:CCGGCGGAATCTAGTGTCTTTCTAACTCGAGTTAGAAAGACACTAGATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-1767s1c1
Sequence:CCGGGCCGCCATTGTAATTGGCATTCTCGAGAATGCCAATTACAATGGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130830.2-2002s1c1
Sequence:CCGGCCCTAGATAAAGGTGTGCCTACTCGAGTAGGCACACCTTTATCTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-1674s1c1
Sequence:CCGGCCTGTGGAAGACTACACTGATCTCGAGATCAGTGTAGTCTTCCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130830.2-959s1c1
Sequence:CCGGCCGTCTTACTCTCTTTGGGAACTCGAGTTCCCAAAGAGAGTAAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-1118s1c1
Sequence:CCGGCCGCAATCAGATCAGCTTCATCTCGAGATGAAGCTGATCTGATTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-671s1c1
Sequence:CCGGGAAGCTCAATCTGGGCAAGAACTCGAGTTCTTGCCCAGATTGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130830.2-1106s1c1
Sequence:CCGGCCTGATTCTTAGCCGCAATCACTCGAGTGATTGCGGCTAAGAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130830.2-887s1c1
Sequence:CCGGGAGACTCTACCTGTCCAACAACTCGAGTTGTTGGACAGGTAGAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130830.2-2502s1c1
Sequence:CCGGGCTATGAAAGAGAGAAGGAAACTCGAGTTTCCTTCTCTCTTTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130830.2-5675s1c1
Sequence:CCGGCCAGGTTTCTTCTTCTCTTAACTCGAGTTAAGAGAAGAAGAAACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028973
LRRC15 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-772s1c1
Sequence:CCGGCCCTGGCTTGTTCCACAATAACTCGAGTTATTGTGGAACAAGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-521s1c1
Sequence:CCGGCTCCAGTTGTATGGCAACAATCTCGAGATTGTTGCCATACAACTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-1304s1c1
Sequence:CCGGCTGTGTGAGCTTCGTCTCTATCTCGAGATAGAGACGAAGCTCACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-1682s1c1
Sequence:CCGGGCCATTGTGATTGGCATCATACTCGAGTATGATGCCAATCACAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028973.1-3192s1c1
Sequence:CCGGGCGTGTTTACAGACAGCAGATCTCGAGATCTGCTGTCTGTAAACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028973
LRRC15 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-772s1c1
Sequence:CCGGCCCTGGCTTGTTCCACAATAACTCGAGTTATTGTGGAACAAGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-521s1c1
Sequence:CCGGCTCCAGTTGTATGGCAACAATCTCGAGATTGTTGCCATACAACTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-1304s1c1
Sequence:CCGGCTGTGTGAGCTTCGTCTCTATCTCGAGATAGAGACGAAGCTCACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-1682s1c1
Sequence:CCGGGCCATTGTGATTGGCATCATACTCGAGTATGATGCCAATCACAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028973.1-3192s1c1
Sequence:CCGGGCGTGTTTACAGACAGCAGATCTCGAGATCTGCTGTCTGTAAACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028973
LRRC15 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-772s1c1
Sequence:CCGGCCCTGGCTTGTTCCACAATAACTCGAGTTATTGTGGAACAAGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-521s1c1
Sequence:CCGGCTCCAGTTGTATGGCAACAATCTCGAGATTGTTGCCATACAACTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-1304s1c1
Sequence:CCGGCTGTGTGAGCTTCGTCTCTATCTCGAGATAGAGACGAAGCTCACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028973.1-1682s1c1
Sequence:CCGGGCCATTGTGATTGGCATCATACTCGAGTATGATGCCAATCACAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028973.1-3192s1c1
Sequence:CCGGGCGTGTTTACAGACAGCAGATCTCGAGATCTGCTGTCTGTAAACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)