EMAIL THIS PAGE TO A FRIEND

LRRC16A

leucine rich repeat containing 16A

105 Gene Product Result for
Synonyms: CARMIL CARMIL1 CARMIL1a LRRC16 dJ501N12.1 dJ501N12.5
UniProtKB ID: Q5VZK9, Q6ZUH5, Q6ZW07, Q9NXU7
Gene ID:
Mouse(68732) leucine rich repeat containing 16A
Rat(306941) leucine rich repeat containing 16A
chicken(421002) leucine rich repeat containing 16A
cow(537314) leucine rich repeat containing 16A
Horse(100052653) leucine rich repeat containing 16A
domestic cat(101086228) leucine rich repeat containing 16A
dog(488249) leucine rich repeat containing 16A
domestic guinea pig(100724925) leucine rich repeat containing 16A
naked mole-rat(101716594) leucine rich repeat containing 16A
Domestic Rabbit(100350336) leucine rich repeat containing 16A
sheep(101116184) leucine rich repeat containing 16A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017640 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017640 Rosetta Predictions human pricing
XM_001070748 Rosetta Predictions rat pricing
XM_225336 Rosetta Predictions rat pricing
NM_026825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183050 predicted 2102
2 SASI_Hs01_00183052 predicted 3620
3 SASI_Hs02_00350332 predicted 2759
4 SASI_Hs01_00183053 predicted 935
5 SASI_Hs01_00183054 predicted 1827
6 SASI_Hs01_00183055 predicted 2473
7 SASI_Hs01_00183057 predicted 1210
8 SASI_Hs01_00183058 predicted 1600
9 SASI_Hs02_00350333 predicted 2581
10 SASI_Hs01_00183059 predicted 2956
11 SASI_Hs01_00183051 predicted 1297
12 SASI_Hs01_00183056 predicted 2036
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332675 predicted 397
2 SASI_Rn02_00332676 predicted 348
3 SASI_Rn02_00332677 predicted 1548
4 SASI_Rn02_00332678 predicted 2043
5 SASI_Rn02_00332679 predicted 1955
6 SASI_Rn02_00332680 predicted 2061
7 SASI_Rn02_00332681 predicted 2246
8 SASI_Rn02_00332682 predicted 2648
9 SASI_Rn02_00332683 predicted 368
10 SASI_Rn02_00332684 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382729 predicted 406
2 SASI_Rn02_00382730 predicted 347
3 SASI_Rn02_00382731 predicted 1541
4 SASI_Rn02_00382732 predicted 2050
5 SASI_Rn02_00382733 predicted 1961
6 SASI_Rn02_00382734 predicted 2063
7 SASI_Rn02_00382735 predicted 2248
8 SASI_Rn02_00382736 predicted 2649
9 SASI_Rn02_00382737 predicted 371
10 SASI_Rn02_00382738 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156496 predicted 2790
2 SASI_Mm01_00156497 predicted 1241
3 SASI_Mm01_00156498 predicted 848
4 SASI_Mm01_00156499 predicted 2082
5 SASI_Mm02_00330978 predicted 2257
6 SASI_Mm01_00156500 predicted 1982
7 SASI_Mm01_00156501 predicted 2998
8 SASI_Mm01_00156502 predicted 745
9 SASI_Mm01_00156503 predicted 2275
10 SASI_Mm01_00156504 predicted 2069
11 SASI_Mm01_00156505 predicted 1074
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017640
VALIDATED
LRRC16A MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 16A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017640.4-4633s21c1
Sequence:CCGGTTAATGAAAGCCAGCAATTATCTCGAGATAATTGCTGGCTTTCATTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017640.4-3321s21c1
Sequence:CCGGTGGAACACTTTACCAAGTTAACTCGAGTTAACTTGGTAAAGTGTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-451s1c1
Sequence:CCGGCCAGCAGATGATTGACAGAATCTCGAGATTCTGTCAATCATCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-746s1c1
Sequence:CCGGGCTGAGAATCTTTGTCCCAATCTCGAGATTGGGACAAAGATTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-2262s1c1
Sequence:CCGGCCCAGGAGTATCAAGAACAAACTCGAGTTTGTTCTTGATACTCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017640.2-1912s1c1
Sequence:CCGGGCAAGAGAACCGCTTTGGTTTCTCGAGAAACCAAAGCGGTTCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-956s1c1
Sequence:CCGGGCACTCTCACATTGCCATCATCTCGAGATGATGGCAATGTGAGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017640.2-1046s1c1
Sequence:CCGGGCTGAGGAGAAGCCAGTTAAACTCGAGTTTAACTGGCTTCTCCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017640.4-911s21c1
Sequence:CCGGCAATGGGATGTGGATACAATTCTCGAGAATTGTATCCACATCCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017640
VALIDATED
LRRC16A MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 16A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017640.4-4633s21c1
Sequence:CCGGTTAATGAAAGCCAGCAATTATCTCGAGATAATTGCTGGCTTTCATTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017640.4-3321s21c1
Sequence:CCGGTGGAACACTTTACCAAGTTAACTCGAGTTAACTTGGTAAAGTGTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-451s1c1
Sequence:CCGGCCAGCAGATGATTGACAGAATCTCGAGATTCTGTCAATCATCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-746s1c1
Sequence:CCGGGCTGAGAATCTTTGTCCCAATCTCGAGATTGGGACAAAGATTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-2262s1c1
Sequence:CCGGCCCAGGAGTATCAAGAACAAACTCGAGTTTGTTCTTGATACTCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017640.2-1912s1c1
Sequence:CCGGGCAAGAGAACCGCTTTGGTTTCTCGAGAAACCAAAGCGGTTCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-956s1c1
Sequence:CCGGGCACTCTCACATTGCCATCATCTCGAGATGATGGCAATGTGAGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017640.2-1046s1c1
Sequence:CCGGGCTGAGGAGAAGCCAGTTAAACTCGAGTTTAACTGGCTTCTCCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017640.4-911s21c1
Sequence:CCGGCAATGGGATGTGGATACAATTCTCGAGAATTGTATCCACATCCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017640
VALIDATED
LRRC16A MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 16A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017640.4-4633s21c1
Sequence:CCGGTTAATGAAAGCCAGCAATTATCTCGAGATAATTGCTGGCTTTCATTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017640.4-3321s21c1
Sequence:CCGGTGGAACACTTTACCAAGTTAACTCGAGTTAACTTGGTAAAGTGTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-451s1c1
Sequence:CCGGCCAGCAGATGATTGACAGAATCTCGAGATTCTGTCAATCATCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-746s1c1
Sequence:CCGGGCTGAGAATCTTTGTCCCAATCTCGAGATTGGGACAAAGATTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-2262s1c1
Sequence:CCGGCCCAGGAGTATCAAGAACAAACTCGAGTTTGTTCTTGATACTCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017640.2-1912s1c1
Sequence:CCGGGCAAGAGAACCGCTTTGGTTTCTCGAGAAACCAAAGCGGTTCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017640.2-956s1c1
Sequence:CCGGGCACTCTCACATTGCCATCATCTCGAGATGATGGCAATGTGAGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017640.2-1046s1c1
Sequence:CCGGGCTGAGGAGAAGCCAGTTAAACTCGAGTTTAACTGGCTTCTCCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017640.4-911s21c1
Sequence:CCGGCAATGGGATGTGGATACAATTCTCGAGAATTGTATCCACATCCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026825
VALIDATED
LRRC16A MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 16A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026825.2-4411s1c1
Sequence:CCGGGCTTTCTTCTTTCTCTCCTTTCTCGAGAAAGGAGAGAAAGAAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026825.2-2194s1c1
Sequence:CCGGCGGAATCATGAGACCAGGAAACTCGAGTTTCCTGGTCTCATGATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026825.2-222s1c1
Sequence:CCGGCCGGGAGTTAATGGAAAGCATCTCGAGATGCTTTCCATTAACTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026825.2-2685s1c1
Sequence:CCGGCGGGATTGACATTCTTAACAACTCGAGTTGTTAAGAATGTCAATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026825.2-1432s1c1
Sequence:CCGGCCTCCGTCTTTCAAGCAGTTTCTCGAGAAACTGCTTGAAAGACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026825
VALIDATED
LRRC16A MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 16A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026825.2-4411s1c1
Sequence:CCGGGCTTTCTTCTTTCTCTCCTTTCTCGAGAAAGGAGAGAAAGAAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026825.2-2194s1c1
Sequence:CCGGCGGAATCATGAGACCAGGAAACTCGAGTTTCCTGGTCTCATGATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026825.2-222s1c1
Sequence:CCGGCCGGGAGTTAATGGAAAGCATCTCGAGATGCTTTCCATTAACTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026825.2-2685s1c1
Sequence:CCGGCGGGATTGACATTCTTAACAACTCGAGTTGTTAAGAATGTCAATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026825.2-1432s1c1
Sequence:CCGGCCTCCGTCTTTCAAGCAGTTTCTCGAGAAACTGCTTGAAAGACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026825
VALIDATED
LRRC16A MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 16A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026825.2-4411s1c1
Sequence:CCGGGCTTTCTTCTTTCTCTCCTTTCTCGAGAAAGGAGAGAAAGAAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026825.2-2194s1c1
Sequence:CCGGCGGAATCATGAGACCAGGAAACTCGAGTTTCCTGGTCTCATGATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026825.2-222s1c1
Sequence:CCGGCCGGGAGTTAATGGAAAGCATCTCGAGATGCTTTCCATTAACTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026825.2-2685s1c1
Sequence:CCGGCGGGATTGACATTCTTAACAACTCGAGTTGTTAAGAATGTCAATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026825.2-1432s1c1
Sequence:CCGGCCTCCGTCTTTCAAGCAGTTTCTCGAGAAACTGCTTGAAAGACGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)