EMAIL THIS PAGE TO A FRIEND

LRRC16B

leucine rich repeat containing 16B

69 Gene Product Result for
Synonyms: C14orf121 CARMIL3 crml-1
UniProtKB ID: Q8ND23, Q8TEF7, Q96HS9
Gene ID:
Mouse(268747) leucine rich repeat containing 16B
Rat(361041) leucine rich repeat containing 16B
sheep(101120924) leucine rich repeat containing 16B
naked mole-rat(101707798) leucine rich repeat containing 16B
domestic guinea pig(100718608) leucine rich repeat containing 16B
dog(490619) leucine rich repeat containing 16B
domestic cat(101098388) leucine rich repeat containing 16B
cow(517186) leucine rich repeat containing 16B
Horse(100052034) leucine rich repeat containing 16B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU205091 MISSION® esiRNA esiRNA targeting mouse Lrrc16b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138360 Rosetta Predictions human pricing
NM_001014138 Rosetta Predictions rat pricing
NM_001024645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054772 predicted 1699
2 SASI_Hs01_00054773 predicted 3942
3 SASI_Hs01_00054774 predicted 3060
4 SASI_Hs02_00363454 predicted 372
5 SASI_Hs01_00054776 predicted 1955
6 SASI_Hs01_00054777 predicted 1271
7 SASI_Hs02_00363455 predicted 512
8 SASI_Hs01_00054778 predicted 756
9 SASI_Hs01_00054779 predicted 2656
10 SASI_Hs01_00054780 predicted 588
11 SASI_Hs01_00054775 predicted 2880
12 SASI_Hs01_00054781 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119855 predicted 445
2 SASI_Rn01_00119856 predicted 1651
3 SASI_Rn01_00119857 predicted 2105
4 SASI_Rn01_00119858 predicted 685
5 SASI_Rn01_00119859 predicted 1993
6 SASI_Rn01_00119860 predicted 945
7 SASI_Rn01_00119861 predicted 850
8 SASI_Rn01_00119862 predicted 2018
9 SASI_Rn01_00119863 predicted 924
10 SASI_Rn01_00119864 predicted 2150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180995 predicted 2023
2 SASI_Mm01_00180996 predicted 3045
3 SASI_Mm01_00180997 predicted 2462
4 SASI_Mm01_00180998 predicted 1155
5 SASI_Mm01_00180999 predicted 3936
6 SASI_Mm01_00181000 predicted 4195
7 SASI_Mm01_00181001 predicted 2867
8 SASI_Mm01_00181003 predicted 2687
9 SASI_Mm02_00287650 predicted 576
10 SASI_Mm02_00287651 predicted 699
11 SASI_Mm01_00181002 predicted 593
12 SASI_Mm01_00181004 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138360
LRRC16B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 16B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-1425s21c1
Sequence:CCGGACACACTGAGCCACGTCAATCCTCGAGGATTGACGTGGCTCAGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-2844s21c1
Sequence:CCGGATGAACTTGGGACCAACATTGCTCGAGCAATGTTGGTCCCAAGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-2886s21c1
Sequence:CCGGAGAAACGCTGCCGCAAGATTCCTCGAGGAATCTTGCGGCAGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138360.3-4304s21c1
Sequence:CCGGTCGACATGTGCCTCGCAAGGACTCGAGTCCTTGCGAGGCACATGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-1963s21c1
Sequence:CCGGCCTATGGGATCGGAACAATACCTCGAGGTATTGTTCCGATCCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138360.2-2835s1c1
Sequence:CCGGCCACAGATGATGAACTTGGGACTCGAGTCCCAAGTTCATCATCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138360.2-1708s1c1
Sequence:CCGGGAACTTCAATGTCAAGGCCAACTCGAGTTGGCCTTGACATTGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138360
LRRC16B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 16B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-1425s21c1
Sequence:CCGGACACACTGAGCCACGTCAATCCTCGAGGATTGACGTGGCTCAGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-2844s21c1
Sequence:CCGGATGAACTTGGGACCAACATTGCTCGAGCAATGTTGGTCCCAAGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-2886s21c1
Sequence:CCGGAGAAACGCTGCCGCAAGATTCCTCGAGGAATCTTGCGGCAGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138360.3-4304s21c1
Sequence:CCGGTCGACATGTGCCTCGCAAGGACTCGAGTCCTTGCGAGGCACATGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-1963s21c1
Sequence:CCGGCCTATGGGATCGGAACAATACCTCGAGGTATTGTTCCGATCCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138360.2-2835s1c1
Sequence:CCGGCCACAGATGATGAACTTGGGACTCGAGTCCCAAGTTCATCATCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138360.2-1708s1c1
Sequence:CCGGGAACTTCAATGTCAAGGCCAACTCGAGTTGGCCTTGACATTGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138360
LRRC16B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 16B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-1425s21c1
Sequence:CCGGACACACTGAGCCACGTCAATCCTCGAGGATTGACGTGGCTCAGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-2844s21c1
Sequence:CCGGATGAACTTGGGACCAACATTGCTCGAGCAATGTTGGTCCCAAGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-2886s21c1
Sequence:CCGGAGAAACGCTGCCGCAAGATTCCTCGAGGAATCTTGCGGCAGCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138360.3-4304s21c1
Sequence:CCGGTCGACATGTGCCTCGCAAGGACTCGAGTCCTTGCGAGGCACATGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138360.3-1963s21c1
Sequence:CCGGCCTATGGGATCGGAACAATACCTCGAGGTATTGTTCCGATCCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138360.2-2835s1c1
Sequence:CCGGCCACAGATGATGAACTTGGGACTCGAGTCCCAAGTTCATCATCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138360.2-1708s1c1
Sequence:CCGGGAACTTCAATGTCAAGGCCAACTCGAGTTGGCCTTGACATTGAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024645
LRRC16B MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 16B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-1820s1c1
Sequence:CCGGCGCACCAGCATCCTTATCAATCTCGAGATTGATAAGGATGCTGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024645.1-4386s1c1
Sequence:CCGGCAGCAGCACTAAGAAGGCATACTCGAGTATGCCTTCTTAGTGCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-3051s1c1
Sequence:CCGGGCTATAAACTAAGGCATCAAACTCGAGTTTGATGCCTTAGTTTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-1387s1c1
Sequence:CCGGGCCAGCCTTCAAGCAATTCTTCTCGAGAAGAATTGCTTGAAGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-3910s1c1
Sequence:CCGGCGCCTTATTCCCAGAGAGAATCTCGAGATTCTCTCTGGGAATAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024645
LRRC16B MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 16B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-1820s1c1
Sequence:CCGGCGCACCAGCATCCTTATCAATCTCGAGATTGATAAGGATGCTGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024645.1-4386s1c1
Sequence:CCGGCAGCAGCACTAAGAAGGCATACTCGAGTATGCCTTCTTAGTGCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-3051s1c1
Sequence:CCGGGCTATAAACTAAGGCATCAAACTCGAGTTTGATGCCTTAGTTTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-1387s1c1
Sequence:CCGGGCCAGCCTTCAAGCAATTCTTCTCGAGAAGAATTGCTTGAAGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-3910s1c1
Sequence:CCGGCGCCTTATTCCCAGAGAGAATCTCGAGATTCTCTCTGGGAATAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024645
LRRC16B MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 16B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-1820s1c1
Sequence:CCGGCGCACCAGCATCCTTATCAATCTCGAGATTGATAAGGATGCTGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024645.1-4386s1c1
Sequence:CCGGCAGCAGCACTAAGAAGGCATACTCGAGTATGCCTTCTTAGTGCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-3051s1c1
Sequence:CCGGGCTATAAACTAAGGCATCAAACTCGAGTTTGATGCCTTAGTTTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-1387s1c1
Sequence:CCGGGCCAGCCTTCAAGCAATTCTTCTCGAGAAGAATTGCTTGAAGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024645.1-3910s1c1
Sequence:CCGGCGCCTTATTCCCAGAGAGAATCTCGAGATTCTCTCTGGGAATAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)