EMAIL THIS PAGE TO A FRIEND

LRRC18

leucine rich repeat containing 18

62 Gene Product Result for
Synonyms: UNQ933 UNQ9338 VKGE9338
UniProtKB ID: Q8N456, Q6UY02
Gene ID:
Mouse(67580) leucine rich repeat containing 18
Rat(306278) leucine rich repeat containing 18
naked mole-rat(101714199) leucine rich repeat containing 18
domestic guinea pig(100722059) leucine rich repeat containing 18
chicken(101666399) leucine rich repeat containing 18
cow(767998) leucine rich repeat containing 18
dog(606813) leucine rich repeat containing 18
chicken(101751830) leucine rich repeat containing 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026253 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026253 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026253 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001006939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006939 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040771 MISSION® esiRNA esiRNA human LRRC18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006939 Rosetta Predictions human pricing
NM_001013999 Rosetta Predictions rat pricing
NM_026253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305153 predicted 858
2 SASI_Hs01_00170175 predicted 784
3 SASI_Hs01_00170176 predicted 342
4 SASI_Hs01_00170177 predicted 332
5 SASI_Hs01_00170178 predicted 206
6 SASI_Hs01_00170179 predicted 215
7 SASI_Hs01_00170180 predicted 352
8 SASI_Hs02_00305154 predicted 853
9 SASI_Hs01_00170181 predicted 243
10 SASI_Hs01_00170182 predicted 843
11 SASI_Hs01_00170183 predicted 223
12 SASI_Hs01_00170184 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065655 predicted 436
2 SASI_Rn01_00065656 predicted 1029
3 SASI_Rn01_00065657 predicted 783
4 SASI_Rn02_00201363 predicted 316
5 SASI_Rn01_00065659 predicted 987
6 SASI_Rn01_00065660 predicted 827
7 SASI_Rn01_00065661 predicted 1150
8 SASI_Rn01_00065662 predicted 406
9 SASI_Rn01_00065663 predicted 734
10 SASI_Rn01_00065664 predicted 698
11 SASI_Rn01_00065658 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122473 predicted 1489
2 SASI_Mm01_00122475 predicted 462
3 SASI_Mm01_00122476 predicted 563
4 SASI_Mm01_00122477 predicted 1400
5 SASI_Mm01_00122478 predicted 1462
6 SASI_Mm02_00329938 predicted 1509
7 SASI_Mm01_00122479 predicted 695
8 SASI_Mm01_00122480 predicted 1137
9 SASI_Mm01_00122481 predicted 1036
10 SASI_Mm01_00122482 predicted 1342
11 SASI_Mm01_00122474 predicted 588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026253
LRRC18 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 18
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-587s21c1
Sequence:CCGGGCTAGATCTTAGCCGGAATATCTCGAGATATTCCGGCTAAGATCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026253.3-2372s21c1
Sequence:CCGGTATGACTCTACCGTCACTTTACTCGAGTAAAGTGACGGTAGAGTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026253.3-930s1c1
Sequence:CCGGCTGAAGAAGCTCAACATAAAGCTCGAGCTTTATGTTGAGCTTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026253.3-959s1c1
Sequence:CCGGCTTCCCAAATGCAGATGAATCCTCGAGGATTCATCTGCATTTGGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-660s21c1
Sequence:CCGGGACCTGCACAGTAACTATATTCTCGAGAATATAGTTACTGTGCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-1205s21c1
Sequence:CCGGCACCTTCTAGAGTAGCTTATGCTCGAGCATAAGCTACTCTAGAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-798s21c1
Sequence:CCGGACCGTGAATCTGGGCCTTAACCTCGAGGTTAAGGCCCAGATTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026253.3-1774s1c1
Sequence:CCGGCGGTGTTCTAACATCTTAATACTCGAGTATTAAGATGTTAGAACACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026253
LRRC18 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 18
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-587s21c1
Sequence:CCGGGCTAGATCTTAGCCGGAATATCTCGAGATATTCCGGCTAAGATCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026253.3-2372s21c1
Sequence:CCGGTATGACTCTACCGTCACTTTACTCGAGTAAAGTGACGGTAGAGTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026253.3-930s1c1
Sequence:CCGGCTGAAGAAGCTCAACATAAAGCTCGAGCTTTATGTTGAGCTTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026253.3-959s1c1
Sequence:CCGGCTTCCCAAATGCAGATGAATCCTCGAGGATTCATCTGCATTTGGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-660s21c1
Sequence:CCGGGACCTGCACAGTAACTATATTCTCGAGAATATAGTTACTGTGCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-1205s21c1
Sequence:CCGGCACCTTCTAGAGTAGCTTATGCTCGAGCATAAGCTACTCTAGAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-798s21c1
Sequence:CCGGACCGTGAATCTGGGCCTTAACCTCGAGGTTAAGGCCCAGATTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026253.3-1774s1c1
Sequence:CCGGCGGTGTTCTAACATCTTAATACTCGAGTATTAAGATGTTAGAACACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026253
LRRC18 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 18
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-587s21c1
Sequence:CCGGGCTAGATCTTAGCCGGAATATCTCGAGATATTCCGGCTAAGATCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026253.3-2372s21c1
Sequence:CCGGTATGACTCTACCGTCACTTTACTCGAGTAAAGTGACGGTAGAGTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026253.3-930s1c1
Sequence:CCGGCTGAAGAAGCTCAACATAAAGCTCGAGCTTTATGTTGAGCTTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026253.3-959s1c1
Sequence:CCGGCTTCCCAAATGCAGATGAATCCTCGAGGATTCATCTGCATTTGGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-660s21c1
Sequence:CCGGGACCTGCACAGTAACTATATTCTCGAGAATATAGTTACTGTGCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-1205s21c1
Sequence:CCGGCACCTTCTAGAGTAGCTTATGCTCGAGCATAAGCTACTCTAGAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026253.3-798s21c1
Sequence:CCGGACCGTGAATCTGGGCCTTAACCTCGAGGTTAAGGCCCAGATTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026253.3-1774s1c1
Sequence:CCGGCGGTGTTCTAACATCTTAATACTCGAGTATTAAGATGTTAGAACACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006939
LRRC18 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 18
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-439s1c1
Sequence:CCGGGCTGAAGCAACTCAAGAACATCTCGAGATGTTCTTGAGTTGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167073    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006939.2-1300s1c1
Sequence:CCGGCCAAACCTCATGTTGAGATTTCTCGAGAAATCTCAACATGAGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-751s1c1
Sequence:CCGGCCTGAATAGAATCAAGAACATCTCGAGATGTTCTTGATTCTATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-265s1c1
Sequence:CCGGCCGGAATCTTATCAGGAAGATCTCGAGATCTTCCTGATAAGATTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-804s1c1
Sequence:CCGGCCAATCTGATCTCACCCAATTCTCGAGAATTGGGTGAGATCAGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006939.2-968s1c1
Sequence:CCGGGCAAGTGAGATGTTCTGGAAACTCGAGTTTCCAGAACATCTCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-742s1c1
Sequence:CCGGCCGGGACAACCTGAATAGAATCTCGAGATTCTATTCAGGTTGTCCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-803s1c1
Sequence:CCGGCCCAATCTGATCTCACCCAATCTCGAGATTGGGTGAGATCAGATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006939
LRRC18 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 18
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-439s1c1
Sequence:CCGGGCTGAAGCAACTCAAGAACATCTCGAGATGTTCTTGAGTTGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167073    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006939.2-1300s1c1
Sequence:CCGGCCAAACCTCATGTTGAGATTTCTCGAGAAATCTCAACATGAGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-751s1c1
Sequence:CCGGCCTGAATAGAATCAAGAACATCTCGAGATGTTCTTGATTCTATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-265s1c1
Sequence:CCGGCCGGAATCTTATCAGGAAGATCTCGAGATCTTCCTGATAAGATTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-804s1c1
Sequence:CCGGCCAATCTGATCTCACCCAATTCTCGAGAATTGGGTGAGATCAGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006939.2-968s1c1
Sequence:CCGGGCAAGTGAGATGTTCTGGAAACTCGAGTTTCCAGAACATCTCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-742s1c1
Sequence:CCGGCCGGGACAACCTGAATAGAATCTCGAGATTCTATTCAGGTTGTCCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-803s1c1
Sequence:CCGGCCCAATCTGATCTCACCCAATCTCGAGATTGGGTGAGATCAGATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006939
LRRC18 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 18
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-439s1c1
Sequence:CCGGGCTGAAGCAACTCAAGAACATCTCGAGATGTTCTTGAGTTGCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167073    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006939.2-1300s1c1
Sequence:CCGGCCAAACCTCATGTTGAGATTTCTCGAGAAATCTCAACATGAGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-751s1c1
Sequence:CCGGCCTGAATAGAATCAAGAACATCTCGAGATGTTCTTGATTCTATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-265s1c1
Sequence:CCGGCCGGAATCTTATCAGGAAGATCTCGAGATCTTCCTGATAAGATTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-804s1c1
Sequence:CCGGCCAATCTGATCTCACCCAATTCTCGAGAATTGGGTGAGATCAGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168613    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006939.2-968s1c1
Sequence:CCGGGCAAGTGAGATGTTCTGGAAACTCGAGTTTCCAGAACATCTCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-742s1c1
Sequence:CCGGCCGGGACAACCTGAATAGAATCTCGAGATTCTATTCAGGTTGTCCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006939.2-803s1c1
Sequence:CCGGCCCAATCTGATCTCACCCAATCTCGAGATTGGGTGAGATCAGATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)