EMAIL THIS PAGE TO A FRIEND

LRRC19

leucine rich repeat containing 19

63 Gene Product Result for
UniProtKB ID: Q9H756, A0AV00, B9EG91
Gene ID:
Mouse(100061) leucine rich repeat containing 19
Rat(680478) leucine rich repeat containing 19
chicken(424561) leucine rich repeat containing 19
cow(100140471) leucine rich repeat containing 19
domestic cat(101093056) leucine rich repeat containing 19
dog(100686083) leucine rich repeat containing 19
domestic guinea pig(100732715) leucine rich repeat containing 19
naked mole-rat(101709428) leucine rich repeat containing 19
sheep(101110303) leucine rich repeat containing 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022901 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038161 MISSION® esiRNA esiRNA human LRRC19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022901 Rosetta Predictions human pricing
NM_001109413 Rosetta Predictions rat pricing
NM_175305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056823 predicted 1013
2 SASI_Hs01_00056824 predicted 236
3 SASI_Hs01_00056826 predicted 332
4 SASI_Hs01_00056827 predicted 490
5 SASI_Hs01_00056828 predicted 252
6 SASI_Hs01_00056829 predicted 280
7 SASI_Hs01_00056830 predicted 1086
8 SASI_Hs01_00056831 predicted 563
9 SASI_Hs01_00056832 predicted 407
10 SASI_Hs02_00356190 predicted 400
11 SASI_Hs01_00056825 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248167 predicted 919
2 SASI_Rn02_00248168 predicted 358
3 SASI_Rn02_00248169 predicted 775
4 SASI_Rn02_00248170 predicted 210
5 SASI_Rn02_00248171 predicted 784
6 SASI_Rn02_00248172 predicted 523
7 SASI_Rn02_00248173 predicted 436
8 SASI_Rn02_00248174 predicted 359
9 SASI_Rn02_00248175 predicted 274
10 SASI_Rn02_00248176 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071048 predicted 609
2 SASI_Mm01_00071049 predicted 206
3 SASI_Mm01_00071050 predicted 1110
4 SASI_Mm01_00071052 predicted 798
5 SASI_Mm01_00071053 predicted 770
6 SASI_Mm02_00346061 predicted 308
7 SASI_Mm01_00071054 predicted 420
8 SASI_Mm01_00071056 predicted 635
9 SASI_Mm01_00071057 predicted 235
10 SASI_Mm02_00346062 predicted 378
11 SASI_Mm01_00071051 predicted 1306
12 SASI_Mm01_00071055 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175305
LRRC19 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 19
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175305.2-682s1c1
Sequence:CCGGGAACACGTCTAATGTGACATTCTCGAGAATGTCACATTAGACGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175305.2-382s1c1
Sequence:CCGGCAGTTTCAGGAATCTTCTCAACTCGAGTTGAGAAGATTCCTGAAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175305.2-438s1c1
Sequence:CCGGGTGTAATTCAACAGGGTTCATCTCGAGATGAACCCTGTTGAATTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-971s21c1
Sequence:CCGGAGTGCCCAGTATGGTACAATACTCGAGTATTGTACCATACTGGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-266s21c1
Sequence:CCGGATCTCAGTTATAACCGAATTACTCGAGTAATTCGGTTATAACTGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175305.4-2366s1c1
Sequence:CCGGCTAATAGCTCACAACATATTACTCGAGTAATATGTTGTGAGCTATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-439s21c1
Sequence:CCGGGTAATTCAACAGGGTTCATTTCTCGAGAAATGAACCCTGTTGAATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175305.4-1622s21c1
Sequence:CCGGACAGGCAGCTTTAACTATATACTCGAGTATATAGTTAAAGCTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-511s21c1
Sequence:CCGGCAACTGAATCCCGATACATTTCTCGAGAAATGTATCGGGATTCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175305
LRRC19 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 19
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175305.2-682s1c1
Sequence:CCGGGAACACGTCTAATGTGACATTCTCGAGAATGTCACATTAGACGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175305.2-382s1c1
Sequence:CCGGCAGTTTCAGGAATCTTCTCAACTCGAGTTGAGAAGATTCCTGAAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175305.2-438s1c1
Sequence:CCGGGTGTAATTCAACAGGGTTCATCTCGAGATGAACCCTGTTGAATTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-971s21c1
Sequence:CCGGAGTGCCCAGTATGGTACAATACTCGAGTATTGTACCATACTGGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-266s21c1
Sequence:CCGGATCTCAGTTATAACCGAATTACTCGAGTAATTCGGTTATAACTGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175305.4-2366s1c1
Sequence:CCGGCTAATAGCTCACAACATATTACTCGAGTAATATGTTGTGAGCTATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-439s21c1
Sequence:CCGGGTAATTCAACAGGGTTCATTTCTCGAGAAATGAACCCTGTTGAATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175305.4-1622s21c1
Sequence:CCGGACAGGCAGCTTTAACTATATACTCGAGTATATAGTTAAAGCTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-511s21c1
Sequence:CCGGCAACTGAATCCCGATACATTTCTCGAGAAATGTATCGGGATTCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175305
LRRC19 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 19
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175305.2-682s1c1
Sequence:CCGGGAACACGTCTAATGTGACATTCTCGAGAATGTCACATTAGACGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175305.2-382s1c1
Sequence:CCGGCAGTTTCAGGAATCTTCTCAACTCGAGTTGAGAAGATTCCTGAAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175305.2-438s1c1
Sequence:CCGGGTGTAATTCAACAGGGTTCATCTCGAGATGAACCCTGTTGAATTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-971s21c1
Sequence:CCGGAGTGCCCAGTATGGTACAATACTCGAGTATTGTACCATACTGGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-266s21c1
Sequence:CCGGATCTCAGTTATAACCGAATTACTCGAGTAATTCGGTTATAACTGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175305.4-2366s1c1
Sequence:CCGGCTAATAGCTCACAACATATTACTCGAGTAATATGTTGTGAGCTATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-439s21c1
Sequence:CCGGGTAATTCAACAGGGTTCATTTCTCGAGAAATGAACCCTGTTGAATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175305.4-1622s21c1
Sequence:CCGGACAGGCAGCTTTAACTATATACTCGAGTATATAGTTAAAGCTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175305.4-511s21c1
Sequence:CCGGCAACTGAATCCCGATACATTTCTCGAGAAATGTATCGGGATTCAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022901
LRRC19 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 19
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136999    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022901.1-2064s1c1
Sequence:CCGGCCAGAGAGACATTCACAAGTACTCGAGTACTTGTGAATGTCTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-421s1c1
Sequence:CCGGGTAATTCAACAGGGTGCATTTCTCGAGAAATGCACCCTGTTGAATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-578s1c1
Sequence:CCGGCACCACTATTTCATCTGGAATCTCGAGATTCCAGATGAAATAGTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022901.1-2328s1c1
Sequence:CCGGGCCTGGCTAATTTCTGTATTTCTCGAGAAATACAGAAATTAGCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-817s1c1
Sequence:CCGGCAGCCCATCAGCAATTCAATACTCGAGTATTGAATTGCTGATGGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-654s1c1
Sequence:CCGGGAACTGGTTGAACACATCAAACTCGAGTTTGATGTGTTCAACCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022901
LRRC19 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 19
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136999    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022901.1-2064s1c1
Sequence:CCGGCCAGAGAGACATTCACAAGTACTCGAGTACTTGTGAATGTCTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-421s1c1
Sequence:CCGGGTAATTCAACAGGGTGCATTTCTCGAGAAATGCACCCTGTTGAATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-578s1c1
Sequence:CCGGCACCACTATTTCATCTGGAATCTCGAGATTCCAGATGAAATAGTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022901.1-2328s1c1
Sequence:CCGGGCCTGGCTAATTTCTGTATTTCTCGAGAAATACAGAAATTAGCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-817s1c1
Sequence:CCGGCAGCCCATCAGCAATTCAATACTCGAGTATTGAATTGCTGATGGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-654s1c1
Sequence:CCGGGAACTGGTTGAACACATCAAACTCGAGTTTGATGTGTTCAACCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022901
LRRC19 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 19
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136999    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022901.1-2064s1c1
Sequence:CCGGCCAGAGAGACATTCACAAGTACTCGAGTACTTGTGAATGTCTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-421s1c1
Sequence:CCGGGTAATTCAACAGGGTGCATTTCTCGAGAAATGCACCCTGTTGAATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-578s1c1
Sequence:CCGGCACCACTATTTCATCTGGAATCTCGAGATTCCAGATGAAATAGTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022901.1-2328s1c1
Sequence:CCGGGCCTGGCTAATTTCTGTATTTCTCGAGAAATACAGAAATTAGCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-817s1c1
Sequence:CCGGCAGCCCATCAGCAATTCAATACTCGAGTATTGAATTGCTGATGGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022901.1-654s1c1
Sequence:CCGGGAACTGGTTGAACACATCAAACTCGAGTTTGATGTGTTCAACCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)