EMAIL THIS PAGE TO A FRIEND

LRRC1

leucine rich repeat containing 1

101 Gene Product Result for
Synonyms: LANO dJ523E19.1
UniProtKB ID: Q9BTT6, Q5TGN3, Q9HAC0, Q9NVF1
Gene ID:
Mouse(214345) leucine rich repeat containing 1
Rat(367113) leucine rich repeat containing 1
Zebrafish(541316) leucine rich repeat containing 1
domestic cat(101096810) leucine rich repeat containing 1
Horse(100069525) leucine rich repeat containing 1
cow(506753) leucine rich repeat containing 1
dog(481847) leucine rich repeat containing 1
chicken(421891) leucine rich repeat containing 1
naked mole-rat(101721247) leucine rich repeat containing 1
domestic guinea pig(100731920) leucine rich repeat containing 1
sheep(101114315) leucine rich repeat containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018214 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018214 Rosetta Predictions human pricing
NM_001014268 Rosetta Predictions rat pricing
NM_172528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236996 predicted 997
2 SASI_Hs01_00236997 predicted 1582
3 SASI_Hs01_00236998 predicted 529
4 SASI_Hs01_00236999 predicted 1534
5 SASI_Hs01_00237000 predicted 1391
6 SASI_Hs01_00237001 predicted 1136
7 SASI_Hs01_00237002 predicted 1038
8 SASI_Hs01_00237003 predicted 1027
9 SASI_Hs01_00237004 predicted 847
10 SASI_Hs01_00237005 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201838 predicted 694
2 SASI_Rn01_00061906 predicted 1668
3 SASI_Rn01_00061907 predicted 865
4 SASI_Rn01_00061908 predicted 1201
5 SASI_Rn01_00061909 predicted 905
6 SASI_Rn01_00061912 predicted 1056
7 SASI_Rn02_00201839 predicted 831
8 SASI_Rn01_00061913 predicted 1206
9 SASI_Rn01_00061914 predicted 603
10 SASI_Rn02_00201840 predicted 738
11 SASI_Rn01_00061910 predicted 366
12 SASI_Rn01_00061911 predicted 288
13 SASI_Rn01_00061915 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073932 predicted 643
2 SASI_Mm01_00073934 predicted 1448
3 SASI_Mm01_00073935 predicted 420
4 SASI_Mm02_00344137 predicted 689
5 SASI_Mm01_00073936 predicted 704
6 SASI_Mm01_00073937 predicted 256
7 SASI_Mm01_00073938 predicted 1355
8 SASI_Mm01_00073939 predicted 826
9 SASI_Mm01_00073940 predicted 387
10 SASI_Mm01_00073941 predicted 975
11 SASI_Mm01_00073933 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018214
VALIDATED
LRRC1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-1838s21c1
Sequence:CCGGACCACTTCTGTGTAGAGTTTCCTCGAGGAAACTCTACACAGAAGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-800s21c1
Sequence:CCGGAGACTAGAAGAACTTGATTTACTCGAGTAAATCAAGTTCTTCTAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-856s21c1
Sequence:CCGGTGGAGCCCTCTTACATCTAAACTCGAGTTTAGATGTAAGAGGGCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018214.3-1132s1c1
Sequence:CCGGCATATCTTCCTGACTCTCTTACTCGAGTAAGAGAGTCAGGAAGATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-809s1c1
Sequence:CCGGCCAGCTAGTCAAATTACGAAACTCGAGTTTCGTAATTTGACTAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-1084s1c1
Sequence:CCGGGCAATCTTTATAACCTGGCTTCTCGAGAAGCCAGGTTATAAAGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-1161s1c1
Sequence:CCGGCGAAGACTAGAAGAACTTGATCTCGAGATCAAGTTCTTCTAGTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-812s1c1
Sequence:CCGGGCTAGTCAAATTACGAAAGCTCTCGAGAGCTTTCGTAATTTGACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-1300s21c1
Sequence:CCGGTGTACGTGACAACAGACTAACCTCGAGGTTAGTCTGTTGTCACGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-1637s21c1
Sequence:CCGGAGAGTCAGTGCGATCCGATTTCTCGAGAAATCGGATCGCACTGACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018214.3-897s1c1
Sequence:CCGGGAACTAGATGTGTCTCGAAATCTCGAGATTTCGAGACACATCTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-625s21c1
Sequence:CCGGACTGACTAGGTTGCCAGAAAGCTCGAGCTTTCTGGCAACCTAGTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018214
VALIDATED
LRRC1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-1838s21c1
Sequence:CCGGACCACTTCTGTGTAGAGTTTCCTCGAGGAAACTCTACACAGAAGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-800s21c1
Sequence:CCGGAGACTAGAAGAACTTGATTTACTCGAGTAAATCAAGTTCTTCTAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-856s21c1
Sequence:CCGGTGGAGCCCTCTTACATCTAAACTCGAGTTTAGATGTAAGAGGGCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018214.3-1132s1c1
Sequence:CCGGCATATCTTCCTGACTCTCTTACTCGAGTAAGAGAGTCAGGAAGATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-809s1c1
Sequence:CCGGCCAGCTAGTCAAATTACGAAACTCGAGTTTCGTAATTTGACTAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-1084s1c1
Sequence:CCGGGCAATCTTTATAACCTGGCTTCTCGAGAAGCCAGGTTATAAAGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-1161s1c1
Sequence:CCGGCGAAGACTAGAAGAACTTGATCTCGAGATCAAGTTCTTCTAGTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-812s1c1
Sequence:CCGGGCTAGTCAAATTACGAAAGCTCTCGAGAGCTTTCGTAATTTGACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-1300s21c1
Sequence:CCGGTGTACGTGACAACAGACTAACCTCGAGGTTAGTCTGTTGTCACGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-1637s21c1
Sequence:CCGGAGAGTCAGTGCGATCCGATTTCTCGAGAAATCGGATCGCACTGACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018214.3-897s1c1
Sequence:CCGGGAACTAGATGTGTCTCGAAATCTCGAGATTTCGAGACACATCTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-625s21c1
Sequence:CCGGACTGACTAGGTTGCCAGAAAGCTCGAGCTTTCTGGCAACCTAGTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018214
VALIDATED
LRRC1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-1838s21c1
Sequence:CCGGACCACTTCTGTGTAGAGTTTCCTCGAGGAAACTCTACACAGAAGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-800s21c1
Sequence:CCGGAGACTAGAAGAACTTGATTTACTCGAGTAAATCAAGTTCTTCTAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-856s21c1
Sequence:CCGGTGGAGCCCTCTTACATCTAAACTCGAGTTTAGATGTAAGAGGGCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018214.3-1132s1c1
Sequence:CCGGCATATCTTCCTGACTCTCTTACTCGAGTAAGAGAGTCAGGAAGATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-809s1c1
Sequence:CCGGCCAGCTAGTCAAATTACGAAACTCGAGTTTCGTAATTTGACTAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-1084s1c1
Sequence:CCGGGCAATCTTTATAACCTGGCTTCTCGAGAAGCCAGGTTATAAAGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-1161s1c1
Sequence:CCGGCGAAGACTAGAAGAACTTGATCTCGAGATCAAGTTCTTCTAGTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018214.3-812s1c1
Sequence:CCGGGCTAGTCAAATTACGAAAGCTCTCGAGAGCTTTCGTAATTTGACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-1300s21c1
Sequence:CCGGTGTACGTGACAACAGACTAACCTCGAGGTTAGTCTGTTGTCACGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-1637s21c1
Sequence:CCGGAGAGTCAGTGCGATCCGATTTCTCGAGAAATCGGATCGCACTGACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018214.3-897s1c1
Sequence:CCGGGAACTAGATGTGTCTCGAAATCTCGAGATTTCGAGACACATCTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018214.4-625s21c1
Sequence:CCGGACTGACTAGGTTGCCAGAAAGCTCGAGCTTTCTGGCAACCTAGTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172528
LRRC1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-461s1c1
Sequence:CCGGGCACTCCTACATCTGAAGGATCTCGAGATCCTTCAGATGTAGGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172528.2-1624s1c1
Sequence:CCGGCCGTCCTAATTCTGTTCAATACTCGAGTATTGAACAGAATTAGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-148s1c1
Sequence:CCGGCCGGAATGATATACCTGAAATCTCGAGATTTCAGGTATATCATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-377s1c1
Sequence:CCGGCCTGACTCTCTTACCCAACTACTCGAGTAGTTGGGTAAGAGAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-753s1c1
Sequence:CCGGCGGAGTTAGTTCTTACAGAAACTCGAGTTTCTGTAAGAACTAACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172528
LRRC1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-461s1c1
Sequence:CCGGGCACTCCTACATCTGAAGGATCTCGAGATCCTTCAGATGTAGGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172528.2-1624s1c1
Sequence:CCGGCCGTCCTAATTCTGTTCAATACTCGAGTATTGAACAGAATTAGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-148s1c1
Sequence:CCGGCCGGAATGATATACCTGAAATCTCGAGATTTCAGGTATATCATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-377s1c1
Sequence:CCGGCCTGACTCTCTTACCCAACTACTCGAGTAGTTGGGTAAGAGAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-753s1c1
Sequence:CCGGCGGAGTTAGTTCTTACAGAAACTCGAGTTTCTGTAAGAACTAACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172528
LRRC1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-461s1c1
Sequence:CCGGGCACTCCTACATCTGAAGGATCTCGAGATCCTTCAGATGTAGGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172528.2-1624s1c1
Sequence:CCGGCCGTCCTAATTCTGTTCAATACTCGAGTATTGAACAGAATTAGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-148s1c1
Sequence:CCGGCCGGAATGATATACCTGAAATCTCGAGATTTCAGGTATATCATTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-377s1c1
Sequence:CCGGCCTGACTCTCTTACCCAACTACTCGAGTAGTTGGGTAAGAGAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172528.2-753s1c1
Sequence:CCGGCGGAGTTAGTTCTTACAGAAACTCGAGTTTCTGTAAGAACTAACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)