EMAIL THIS PAGE TO A FRIEND

LRRC20

leucine rich repeat containing 20

165 Gene Product Result for
UniProtKB ID: Q8TCA0, Q5T6D4, Q5T6D6, Q9NVA6, Q9NVG3
Gene ID:
Mouse(216011) leucine rich repeat containing 20
Rat(499430) leucine rich repeat containing 20
Zebrafish(492485) leucine rich repeat containing 20
cow(521721) leucine rich repeat containing 20
domestic cat(101096416) leucine rich repeat containing 20
dog(609579) leucine rich repeat containing 20
chicken(769461) leucine rich repeat containing 20
domestic guinea pig(100723661) leucine rich repeat containing 20
naked mole-rat(101714611) leucine rich repeat containing 20
Goat(100861079) leucine rich repeat containing 20
sheep(101109855) leucine rich repeat containing 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153542 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153542 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153542 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018205 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU039281 MISSION® esiRNA esiRNA targeting mouse Lrrc20 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018205 Rosetta Predictions human pricing
NM_018239 Rosetta Predictions human pricing
NM_207119 Rosetta Predictions human pricing
NM_001109171 Rosetta Predictions rat pricing
NM_153542 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351501 predicted 991
2 SASI_Hs02_00351502 predicted 772
3 SASI_Hs02_00351503 predicted 959
4 SASI_Hs02_00351504 predicted 693
5 SASI_Hs02_00351505 predicted 790
6 SASI_Hs01_00138638 predicted 663
7 SASI_Hs02_00351506 predicted 981
8 SASI_Hs01_00138634 predicted 929
9 SASI_Hs01_00138635 predicted 353
10 SASI_Hs01_00138636 predicted 404
11 SASI_Hs01_00138637 predicted 992
12 SASI_Hs01_00138639 predicted 196
13 SASI_Hs01_00138640 predicted 988
14 SASI_Hs01_00138641 predicted 418
15 SASI_Hs01_00138642 predicted 311
16 SASI_Hs01_00138643 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200156 predicted 1006
2 SASI_Hs01_00200157 predicted 793
3 SASI_Hs01_00200158 predicted 981
4 SASI_Hs01_00200159 predicted 716
5 SASI_Hs01_00200160 predicted 800
6 SASI_Hs01_00200161 predicted 686
7 SASI_Hs01_00200162 predicted 1002
8 SASI_Hs01_00200163 predicted 952
9 SASI_Hs01_00200164 predicted 284
10 SASI_Hs01_00200165 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191921 predicted 432
2 SASI_Hs01_00191914 predicted 1235
3 SASI_Hs01_00191922 predicted 653
4 SASI_Hs01_00191923 predicted 398
5 SASI_Hs02_00373769 predicted 516
6 SASI_Hs01_00191915 predicted 1023
7 SASI_Hs01_00191916 predicted 1214
8 SASI_Hs01_00191918 predicted 1040
9 SASI_Hs01_00191919 predicted 914
10 SASI_Hs02_00373770 predicted 523
11 SASI_Hs01_00191917 predicted 945
12 SASI_Hs01_00191920 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245820 predicted 1096
2 SASI_Rn02_00245821 predicted 697
3 SASI_Rn02_00245822 predicted 348
4 SASI_Rn02_00245823 predicted 355
5 SASI_Rn02_00245824 predicted 458
6 SASI_Rn02_00245825 predicted 583
7 SASI_Rn02_00245826 predicted 635
8 SASI_Rn02_00245827 predicted 1047
9 SASI_Rn02_00245828 predicted 446
10 SASI_Rn02_00245829 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036224 predicted 267
2 SASI_Mm01_00036225 predicted 1132
3 SASI_Mm01_00036226 predicted 280
4 SASI_Mm01_00036227 predicted 360
5 SASI_Mm01_00036228 predicted 334
6 SASI_Mm01_00036229 predicted 1101
7 SASI_Mm01_00036230 predicted 1027
8 SASI_Mm01_00036231 predicted 1060
9 SASI_Mm01_00036232 predicted 338
10 SASI_Mm01_00036233 predicted 1053
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153542
VALIDATED
LRRC20 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 20
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153542.1-443s1c1
Sequence:CCGGCCAGTTTCAAGACTTCCCAGACTCGAGTCTGGGAAGTCTTGAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153542.1-504s1c1
Sequence:CCGGGAGGAGAATGAGATAGTGGATCTCGAGATCCACTATCTCATTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153542.1-266s1c1
Sequence:CCGGCTCTGATCAGATCCATCTCATCTCGAGATGAGATGGATCTGATCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-1127s21c1
Sequence:CCGGGAGACCACCTCCACCTATTTACTCGAGTAAATAGGTGGAGGTGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-283s21c1
Sequence:CCGGTCATCACGCTGGCTAACAATGCTCGAGCATTGTTAGCCAGCGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-325s21c1
Sequence:CCGGAGTTCATGACCACCTTCAATCCTCGAGGATTGAAGGTGGTCATGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-154s21c1
Sequence:CCGGGAGTTGCGAGGAAGGTCAATGCTCGAGCATTGACCTTCCTCGCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153542.1-617s21c1
Sequence:CCGGACCGCTCATCAAGTTTGATATCTCGAGATATCAAACTTGATGAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153542
VALIDATED
LRRC20 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 20
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153542.1-443s1c1
Sequence:CCGGCCAGTTTCAAGACTTCCCAGACTCGAGTCTGGGAAGTCTTGAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153542.1-504s1c1
Sequence:CCGGGAGGAGAATGAGATAGTGGATCTCGAGATCCACTATCTCATTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153542.1-266s1c1
Sequence:CCGGCTCTGATCAGATCCATCTCATCTCGAGATGAGATGGATCTGATCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-1127s21c1
Sequence:CCGGGAGACCACCTCCACCTATTTACTCGAGTAAATAGGTGGAGGTGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-283s21c1
Sequence:CCGGTCATCACGCTGGCTAACAATGCTCGAGCATTGTTAGCCAGCGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-325s21c1
Sequence:CCGGAGTTCATGACCACCTTCAATCCTCGAGGATTGAAGGTGGTCATGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-154s21c1
Sequence:CCGGGAGTTGCGAGGAAGGTCAATGCTCGAGCATTGACCTTCCTCGCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153542.1-617s21c1
Sequence:CCGGACCGCTCATCAAGTTTGATATCTCGAGATATCAAACTTGATGAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153542
VALIDATED
LRRC20 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 20
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153542.1-443s1c1
Sequence:CCGGCCAGTTTCAAGACTTCCCAGACTCGAGTCTGGGAAGTCTTGAAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153542.1-504s1c1
Sequence:CCGGGAGGAGAATGAGATAGTGGATCTCGAGATCCACTATCTCATTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153542.1-266s1c1
Sequence:CCGGCTCTGATCAGATCCATCTCATCTCGAGATGAGATGGATCTGATCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248075    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-1127s21c1
Sequence:CCGGGAGACCACCTCCACCTATTTACTCGAGTAAATAGGTGGAGGTGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-283s21c1
Sequence:CCGGTCATCACGCTGGCTAACAATGCTCGAGCATTGTTAGCCAGCGTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-325s21c1
Sequence:CCGGAGTTCATGACCACCTTCAATCCTCGAGGATTGAAGGTGGTCATGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153542.1-154s21c1
Sequence:CCGGGAGTTGCGAGGAAGGTCAATGCTCGAGCATTGACCTTCCTCGCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153542.1-617s21c1
Sequence:CCGGACCGCTCATCAAGTTTGATATCTCGAGATATCAAACTTGATGAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018205
VALIDATED
LRRC20 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 20
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018205.2-1566s1c1
Sequence:CCGGCCCAGGACATGGAACTTTCAACTCGAGTTGAAAGTTCCATGTCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018205.2-338s1c1
Sequence:CCGGCCAGCAAGTTCATGACCACATCTCGAGATGTGGTCATGAACTTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-309s21c1
Sequence:CCGGCCTGGCTAACAACGAGCTTAACTCGAGTTAAGCTCGTTGTTAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-2367s21c1
Sequence:CCGGAGTCTAGGCCTCACCCTATACCTCGAGGTATAGGGTGAGGCCTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-264s21c1
Sequence:CCGGCTACAAGGTCCTGCGGAATGTCTCGAGACATTCCGCAGGACCTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-415s21c1
Sequence:CCGGAGCATCAACCTCCGCTTCAACCTCGAGGTTGAAGCGGAGGTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018205.2-340s21c1
Sequence:CCGGAGCAAGTTCATGACCACATTCCTCGAGGAATGTGGTCATGAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018205
VALIDATED
LRRC20 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 20
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018205.2-1566s1c1
Sequence:CCGGCCCAGGACATGGAACTTTCAACTCGAGTTGAAAGTTCCATGTCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018205.2-338s1c1
Sequence:CCGGCCAGCAAGTTCATGACCACATCTCGAGATGTGGTCATGAACTTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-309s21c1
Sequence:CCGGCCTGGCTAACAACGAGCTTAACTCGAGTTAAGCTCGTTGTTAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-2367s21c1
Sequence:CCGGAGTCTAGGCCTCACCCTATACCTCGAGGTATAGGGTGAGGCCTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-264s21c1
Sequence:CCGGCTACAAGGTCCTGCGGAATGTCTCGAGACATTCCGCAGGACCTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-415s21c1
Sequence:CCGGAGCATCAACCTCCGCTTCAACCTCGAGGTTGAAGCGGAGGTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018205.2-340s21c1
Sequence:CCGGAGCAAGTTCATGACCACATTCCTCGAGGAATGTGGTCATGAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018205
VALIDATED
LRRC20 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 20
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172382    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018205.2-1566s1c1
Sequence:CCGGCCCAGGACATGGAACTTTCAACTCGAGTTGAAAGTTCCATGTCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018205.2-338s1c1
Sequence:CCGGCCAGCAAGTTCATGACCACATCTCGAGATGTGGTCATGAACTTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-309s21c1
Sequence:CCGGCCTGGCTAACAACGAGCTTAACTCGAGTTAAGCTCGTTGTTAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242910    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-2367s21c1
Sequence:CCGGAGTCTAGGCCTCACCCTATACCTCGAGGTATAGGGTGAGGCCTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-264s21c1
Sequence:CCGGCTACAAGGTCCTGCGGAATGTCTCGAGACATTCCGCAGGACCTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_018205.2-415s21c1
Sequence:CCGGAGCATCAACCTCCGCTTCAACCTCGAGGTTGAAGCGGAGGTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018205.2-340s21c1
Sequence:CCGGAGCAAGTTCATGACCACATTCCTCGAGGAATGTGGTCATGAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)