EMAIL THIS PAGE TO A FRIEND

LRRC23

leucine rich repeat containing 23

62 Gene Product Result for
Synonyms: LRPB7
UniProtKB ID: Q53EV4, A8K8C6, D3DUT1, Q8N6K6, Q92977, Q99620
Gene ID:
Mouse(16977) leucine rich repeat containing 23
Rat(312707) leucine rich repeat containing 23
sheep(101109433) leucine rich repeat containing 23
naked mole-rat(101722312) leucine rich repeat containing 23
domestic guinea pig(100733934) leucine rich repeat containing 23
Zebrafish(450033) leucine rich repeat containing 23
chicken(418291) leucine rich repeat containing 23
dog(611613) leucine rich repeat containing 23
cow(613700) leucine rich repeat containing 23
domestic cat(101086403) leucine rich repeat containing 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006992 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006992 Rosetta Predictions human pricing
NM_201650 Rosetta Predictions human pricing
NM_001013165 Rosetta Predictions rat pricing
NM_013588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022894 predicted 532
2 SASI_Hs01_00022895 predicted 601
3 SASI_Hs01_00022896 predicted 529
4 SASI_Hs01_00022897 predicted 615
5 SASI_Hs01_00022898 predicted 625
6 SASI_Hs01_00022899 predicted 613
7 SASI_Hs01_00022900 predicted 631
8 SASI_Hs01_00022902 predicted 620
9 SASI_Hs01_00022903 predicted 517
10 SASI_Hs02_00342744 predicted 611
11 SASI_Hs01_00022901 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167458 predicted 530
2 SASI_Hs01_00167459 predicted 598
3 SASI_Hs01_00167460 predicted 532
4 SASI_Hs01_00167461 predicted 613
5 SASI_Hs01_00167462 predicted 630
6 SASI_Hs01_00167463 predicted 615
7 SASI_Hs01_00167464 predicted 624
8 SASI_Hs01_00167466 predicted 614
9 SASI_Hs01_00167467 predicted 518
10 SASI_Hs02_00373154 predicted 612
11 SASI_Hs01_00167465 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043257 predicted 599
2 SASI_Rn01_00043258 predicted 1064
3 SASI_Rn02_00200907 predicted 780
4 SASI_Rn01_00043259 predicted 1185
5 SASI_Rn01_00043260 predicted 513
6 SASI_Rn01_00043261 predicted 439
7 SASI_Rn01_00043263 predicted 1292
8 SASI_Rn01_00043264 predicted 1253
9 SASI_Rn01_00043265 predicted 447
10 SASI_Rn01_00043266 predicted 1192
11 SASI_Rn01_00043262 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322328 predicted 1015
2 SASI_Mm01_00165141 predicted 364
3 SASI_Mm01_00165142 predicted 530
4 SASI_Mm01_00165143 predicted 351
5 SASI_Mm01_00165144 predicted 709
6 SASI_Mm01_00165145 predicted 385
7 SASI_Mm01_00165147 predicted 415
8 SASI_Mm01_00165148 predicted 412
9 SASI_Mm01_00165149 predicted 393
10 SASI_Mm01_00165150 predicted 1130
11 SASI_Mm01_00165146 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006992
VALIDATED
LRRC23 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 23
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-799s21c1
Sequence:CCGGCACCCTGGGAATCAATCTTCCCTCGAGGGAAGATTGATTCCCAGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-648s21c1
Sequence:CCGGATAACCAGATTACTGACACTGCTCGAGCAGTGTCAGTAATCTGGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-444s21c1
Sequence:CCGGAGGTTAAAGAGAGGGACCTGACTCGAGTCAGGTCCCTCTCTTTAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-569s21c1
Sequence:CCGGTGGCTCAAGGCTGATGGCAATCTCGAGATTGCCATCAGCCTTGAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-594s21c1
Sequence:CCGGTGCGAAGTGCCCAGATGAATGCTCGAGCATTCATCTGGGCACTTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006992.2-912s1c1
Sequence:CCGGCCTCAACCTGAGGAGATCAAACTCGAGTTTGATCTCCTCAGGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-205s1c1
Sequence:CCGGCAGGATGATTCTGAGAAAGAACTCGAGTTCTTTCTCAGAATCATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006992.2-447s1c1
Sequence:CCGGCTATGTGGATATTTCTGAGAACTCGAGTTCTCAGAAATATCCACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-363s1c1
Sequence:CCGGGCTGGCTCATGCTTATGTCAACTCGAGTTGACATAAGCATGAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-373s1c1
Sequence:CCGGGCTTATGTCAAGCTGGAGGTTCTCGAGAACCTCCAGCTTGACATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-1020s1c1
Sequence:CCGGGCTGGAAATTCATCACAACCTCTCGAGAGGTTGTGATGAATTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006992
VALIDATED
LRRC23 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 23
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-799s21c1
Sequence:CCGGCACCCTGGGAATCAATCTTCCCTCGAGGGAAGATTGATTCCCAGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-648s21c1
Sequence:CCGGATAACCAGATTACTGACACTGCTCGAGCAGTGTCAGTAATCTGGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-444s21c1
Sequence:CCGGAGGTTAAAGAGAGGGACCTGACTCGAGTCAGGTCCCTCTCTTTAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-569s21c1
Sequence:CCGGTGGCTCAAGGCTGATGGCAATCTCGAGATTGCCATCAGCCTTGAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-594s21c1
Sequence:CCGGTGCGAAGTGCCCAGATGAATGCTCGAGCATTCATCTGGGCACTTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006992.2-912s1c1
Sequence:CCGGCCTCAACCTGAGGAGATCAAACTCGAGTTTGATCTCCTCAGGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-205s1c1
Sequence:CCGGCAGGATGATTCTGAGAAAGAACTCGAGTTCTTTCTCAGAATCATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006992.2-447s1c1
Sequence:CCGGCTATGTGGATATTTCTGAGAACTCGAGTTCTCAGAAATATCCACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-363s1c1
Sequence:CCGGGCTGGCTCATGCTTATGTCAACTCGAGTTGACATAAGCATGAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-373s1c1
Sequence:CCGGGCTTATGTCAAGCTGGAGGTTCTCGAGAACCTCCAGCTTGACATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-1020s1c1
Sequence:CCGGGCTGGAAATTCATCACAACCTCTCGAGAGGTTGTGATGAATTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006992
VALIDATED
LRRC23 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 23
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-799s21c1
Sequence:CCGGCACCCTGGGAATCAATCTTCCCTCGAGGGAAGATTGATTCCCAGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-648s21c1
Sequence:CCGGATAACCAGATTACTGACACTGCTCGAGCAGTGTCAGTAATCTGGTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-444s21c1
Sequence:CCGGAGGTTAAAGAGAGGGACCTGACTCGAGTCAGGTCCCTCTCTTTAACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-569s21c1
Sequence:CCGGTGGCTCAAGGCTGATGGCAATCTCGAGATTGCCATCAGCCTTGAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006992.3-594s21c1
Sequence:CCGGTGCGAAGTGCCCAGATGAATGCTCGAGCATTCATCTGGGCACTTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006992.2-912s1c1
Sequence:CCGGCCTCAACCTGAGGAGATCAAACTCGAGTTTGATCTCCTCAGGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-205s1c1
Sequence:CCGGCAGGATGATTCTGAGAAAGAACTCGAGTTCTTTCTCAGAATCATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006992.2-447s1c1
Sequence:CCGGCTATGTGGATATTTCTGAGAACTCGAGTTCTCAGAAATATCCACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-363s1c1
Sequence:CCGGGCTGGCTCATGCTTATGTCAACTCGAGTTGACATAAGCATGAGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-373s1c1
Sequence:CCGGGCTTATGTCAAGCTGGAGGTTCTCGAGAACCTCCAGCTTGACATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006992.2-1020s1c1
Sequence:CCGGGCTGGAAATTCATCACAACCTCTCGAGAGGTTGTGATGAATTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013588
LRRC23 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 23
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-360s21c1
Sequence:CCGGTCCTTACTGCGCTCCTATATCCTCGAGGATATAGGAGCGCAGTAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-383s21c1
Sequence:CCGGTCTTCGCTATGTGGATATTTCCTCGAGGAAATATCCACATAGCGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-1118s21c1
Sequence:CCGGACCGTACTTGCCACCAGTTTACTCGAGTAAACTGGTGGCAAGTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-302s21c1
Sequence:CCGGTGGACTGGCTCACGCTTATATCTCGAGATATAAGCGTGAGCCAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013588.1-1270s21c1
Sequence:CCGGCAGACTGGAAATCCATCACATCTCGAGATGTGATGGATTTCCAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013588
LRRC23 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 23
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-360s21c1
Sequence:CCGGTCCTTACTGCGCTCCTATATCCTCGAGGATATAGGAGCGCAGTAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-383s21c1
Sequence:CCGGTCTTCGCTATGTGGATATTTCCTCGAGGAAATATCCACATAGCGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-1118s21c1
Sequence:CCGGACCGTACTTGCCACCAGTTTACTCGAGTAAACTGGTGGCAAGTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-302s21c1
Sequence:CCGGTGGACTGGCTCACGCTTATATCTCGAGATATAAGCGTGAGCCAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013588.1-1270s21c1
Sequence:CCGGCAGACTGGAAATCCATCACATCTCGAGATGTGATGGATTTCCAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013588
LRRC23 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 23
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-360s21c1
Sequence:CCGGTCCTTACTGCGCTCCTATATCCTCGAGGATATAGGAGCGCAGTAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-383s21c1
Sequence:CCGGTCTTCGCTATGTGGATATTTCCTCGAGGAAATATCCACATAGCGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-1118s21c1
Sequence:CCGGACCGTACTTGCCACCAGTTTACTCGAGTAAACTGGTGGCAAGTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013588.1-302s21c1
Sequence:CCGGTGGACTGGCTCACGCTTATATCTCGAGATATAAGCGTGAGCCAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013588.1-1270s21c1
Sequence:CCGGCAGACTGGAAATCCATCACATCTCGAGATGTGATGGATTTCCAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)