EMAIL THIS PAGE TO A FRIEND

LRRC24

leucine rich repeat containing 24

45 Gene Product Result for
Synonyms: LRRC14OS
UniProtKB ID: Q50LG9
Gene ID:
Mouse(378937) leucine rich repeat containing 24
Rat(362945) leucine rich repeat containing 24
Zebrafish(565790) leucine rich repeat containing 24
cow(512879) leucine rich repeat containing 24
domestic cat(101097946) leucine rich repeat containing 24
dog(609936) leucine rich repeat containing 24
domestic guinea pig(100717161) leucine rich repeat containing 24
naked mole-rat(101709071) leucine rich repeat containing 24
sheep(101106533) leucine rich repeat containing 24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024678 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024678 Rosetta Predictions human pricing
XM_343275 Rosetta Predictions rat pricing
NM_198119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039985 predicted 988
2 SASI_Hs01_00039987 predicted 562
3 SASI_Hs01_00039988 predicted 985
4 SASI_Hs01_00039989 predicted 699
5 SASI_Hs01_00039990 predicted 930
6 SASI_Hs01_00039991 predicted 1524
7 SASI_Hs01_00039992 predicted 882
8 SASI_Hs01_00039993 predicted 816
9 SASI_Hs01_00039994 predicted 746
10 SASI_Hs02_00307238 predicted 880
11 SASI_Hs01_00039986 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151470 predicted 457
2 SASI_Rn01_00151471 predicted 434
3 SASI_Rn01_00151472 predicted 612
4 SASI_Rn01_00151473 predicted 558
5 SASI_Rn01_00151474 predicted 633
6 SASI_Rn01_00151475 predicted 609
7 SASI_Rn01_00151476 predicted 418
8 SASI_Rn01_00151477 predicted 632
9 SASI_Rn01_00151478 predicted 326
10 SASI_Rn01_00151479 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130541 predicted 1510
2 SASI_Mm01_00130542 predicted 695
3 SASI_Mm01_00130543 predicted 492
4 SASI_Mm01_00130545 predicted 935
5 SASI_Mm01_00130546 predicted 1587
6 SASI_Mm01_00130547 predicted 993
7 SASI_Mm01_00130548 predicted 1581
8 SASI_Mm01_00130549 predicted 612
9 SASI_Mm01_00130550 predicted 733
10 SASI_Mm02_00350867 predicted 1349
11 SASI_Mm01_00130544 predicted 1665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024678
LRRC24 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 24
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024678.1-474s1c1
Sequence:CCGGGCTGGATTTCACCTTCTTGCACTCGAGTGCAAGAAGGTGAAATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024678.1-1047s1c1
Sequence:CCGGCATGCTCTTCCTCAGCAACATCTCGAGATGTTGCTGAGGAAGAGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-879s21c1
Sequence:CCGGACAGCAGCCTCATCTGCATTCCTCGAGGAATGCAGATGAGGCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-810s21c1
Sequence:CCGGCCAGGGACAGGAAGATCATGTCTCGAGACATGATCTTCCTGTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-989s21c1
Sequence:CCGGCCATTGGTGACCTGGAGAAAGCTCGAGCTTTCTCCAGGTCACCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-1450s21c1
Sequence:CCGGAGCGCTGTTCGTCAACGACTACTCGAGTAGTCGTTGACGAACAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024678
LRRC24 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 24
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024678.1-474s1c1
Sequence:CCGGGCTGGATTTCACCTTCTTGCACTCGAGTGCAAGAAGGTGAAATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024678.1-1047s1c1
Sequence:CCGGCATGCTCTTCCTCAGCAACATCTCGAGATGTTGCTGAGGAAGAGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-879s21c1
Sequence:CCGGACAGCAGCCTCATCTGCATTCCTCGAGGAATGCAGATGAGGCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-810s21c1
Sequence:CCGGCCAGGGACAGGAAGATCATGTCTCGAGACATGATCTTCCTGTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-989s21c1
Sequence:CCGGCCATTGGTGACCTGGAGAAAGCTCGAGCTTTCTCCAGGTCACCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-1450s21c1
Sequence:CCGGAGCGCTGTTCGTCAACGACTACTCGAGTAGTCGTTGACGAACAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024678
LRRC24 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 24
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024678.1-474s1c1
Sequence:CCGGGCTGGATTTCACCTTCTTGCACTCGAGTGCAAGAAGGTGAAATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024678.1-1047s1c1
Sequence:CCGGCATGCTCTTCCTCAGCAACATCTCGAGATGTTGCTGAGGAAGAGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-879s21c1
Sequence:CCGGACAGCAGCCTCATCTGCATTCCTCGAGGAATGCAGATGAGGCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-810s21c1
Sequence:CCGGCCAGGGACAGGAAGATCATGTCTCGAGACATGATCTTCCTGTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-989s21c1
Sequence:CCGGCCATTGGTGACCTGGAGAAAGCTCGAGCTTTCTCCAGGTCACCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024678.2-1450s21c1
Sequence:CCGGAGCGCTGTTCGTCAACGACTACTCGAGTAGTCGTTGACGAACAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198119
LRRC24 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 24
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-735s1c1
Sequence:CCGGCAGCATTGAATTACTGGAGGACTCGAGTCCTCCAGTAATTCAATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-426s1c1
Sequence:CCGGGACACTGTTCCTGCAAGACAACTCGAGTTGTCTTGCAGGAACAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-1335s1c1
Sequence:CCGGGCCCTTTCATCTACTGGTCAACTCGAGTTGACCAGTAGATGAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-953s1c1
Sequence:CCGGCCAGAGACAAGAAGATCACATCTCGAGATGTGATCTTCTTGTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198119
LRRC24 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 24
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-735s1c1
Sequence:CCGGCAGCATTGAATTACTGGAGGACTCGAGTCCTCCAGTAATTCAATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-426s1c1
Sequence:CCGGGACACTGTTCCTGCAAGACAACTCGAGTTGTCTTGCAGGAACAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-1335s1c1
Sequence:CCGGGCCCTTTCATCTACTGGTCAACTCGAGTTGACCAGTAGATGAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-953s1c1
Sequence:CCGGCCAGAGACAAGAAGATCACATCTCGAGATGTGATCTTCTTGTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198119
LRRC24 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 24
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-735s1c1
Sequence:CCGGCAGCATTGAATTACTGGAGGACTCGAGTCCTCCAGTAATTCAATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-426s1c1
Sequence:CCGGGACACTGTTCCTGCAAGACAACTCGAGTTGTCTTGCAGGAACAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-1335s1c1
Sequence:CCGGGCCCTTTCATCTACTGGTCAACTCGAGTTGACCAGTAGATGAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198119.1-953s1c1
Sequence:CCGGCCAGAGACAAGAAGATCACATCTCGAGATGTGATCTTCTTGTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)