EMAIL THIS PAGE TO A FRIEND

LRRC25

leucine rich repeat containing 25

58 Gene Product Result for
Synonyms: MAPA
UniProtKB ID: Q8N386, Q6IQ00, Q8N9A5
Gene ID:
Mouse(211228) leucine rich repeat containing 25
Rat(498605) leucine rich repeat containing 25
sheep(101108744) leucine rich repeat containing 25
naked mole-rat(101722802) leucine rich repeat containing 25
domestic guinea pig(101787730) leucine rich repeat containing 25
dog(609889) leucine rich repeat containing 25
domestic cat(101086882) leucine rich repeat containing 25
cow(282599) leucine rich repeat containing 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158701 MISSION® esiRNA esiRNA human LRRC25 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145256 Rosetta Predictions human pricing
XM_001070537 Rosetta Predictions rat pricing
XM_573882 Rosetta Predictions rat pricing
NM_153074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215209 predicted 862
2 SASI_Hs01_00215210 predicted 736
3 SASI_Hs01_00215211 predicted 1002
4 SASI_Hs02_00365109 predicted 816
5 SASI_Hs01_00215213 predicted 900
6 SASI_Hs02_00365110 predicted 1225
7 SASI_Hs01_00215215 predicted 844
8 SASI_Hs01_00215216 predicted 830
9 SASI_Hs02_00365111 predicted 805
10 SASI_Hs02_00365112 predicted 994
11 SASI_Hs01_00215207 predicted 825
12 SASI_Hs01_00215208 predicted 818
13 SASI_Hs01_00215212 predicted 861
14 SASI_Hs01_00215214 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332015 predicted 597
2 SASI_Rn02_00332016 predicted 1142
3 SASI_Rn02_00332017 predicted 803
4 SASI_Rn02_00332018 predicted 642
5 SASI_Rn02_00332019 predicted 525
6 SASI_Rn02_00332020 predicted 777
7 SASI_Rn02_00332021 predicted 417
8 SASI_Rn02_00332022 predicted 293
9 SASI_Rn02_00332023 predicted 707
10 SASI_Rn02_00332024 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152065 predicted 595
2 SASI_Rn01_00152066 predicted 277
3 SASI_Rn01_00152067 predicted 513
4 SASI_Rn01_00152069 predicted 541
5 SASI_Rn01_00152070 predicted 521
6 SASI_Rn01_00152071 predicted 519
7 SASI_Rn01_00152072 predicted 415
8 SASI_Rn01_00152073 predicted 289
9 SASI_Rn01_00152074 predicted 575
10 SASI_Rn02_00400983 predicted 280
11 SASI_Rn01_00152068 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163585 predicted 698
2 SASI_Mm01_00163586 predicted 466
3 SASI_Mm01_00163587 predicted 917
4 SASI_Mm01_00163588 predicted 564
5 SASI_Mm01_00163589 predicted 908
6 SASI_Mm02_00342900 predicted 299
7 SASI_Mm01_00163590 predicted 201
8 SASI_Mm01_00163591 predicted 520
9 SASI_Mm01_00163593 predicted 277
10 SASI_Mm01_00163594 predicted 606
11 SASI_Mm01_00163592 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145256
LRRC25 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 25
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145256.2-1424s21c1
Sequence:CCGGCTCACCCTTCAGAGGACAATGCTCGAGCATTGTCCTCTGAAGGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145256.2-758s21c1
Sequence:CCGGGTGCCACGTGCCTGAATTTCACTCGAGTGAAATTCAGGCACGTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145256.2-902s21c1
Sequence:CCGGTTGAGGTCCTGAACGTGCTACCTCGAGGTAGCACGTTCAGGACCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145256.2-1428s1c1
Sequence:CCGGCCCTTCAGAGGACAATGACTTCTCGAGAAGTCATTGTCCTCTGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145256.2-1491s1c1
Sequence:CCGGCTACTGTAACCTGCAGTCACTCTCGAGAGTGACTGCAGGTTACAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145256.2-829s1c1
Sequence:CCGGGTGATTCTCCTTGACCTGTCTCTCGAGAGACAGGTCAAGGAGAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145256.2-1659s1c1
Sequence:CCGGGAATGGGTACAGGAAAGGATTCTCGAGAATCCTTTCCTGTACCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145256.2-1665s1c1
Sequence:CCGGGTACAGGAAAGGATTGTCCTTCTCGAGAAGGACAATCCTTTCCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145256.2-1452s1c1
Sequence:CCGGCATCAACTACAAGGACATCGACTCGAGTCGATGTCCTTGTAGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145256.2-865s1c1
Sequence:CCGGGAGCTTCCAGTGACCTTCTTTCTCGAGAAAGAAGGTCACTGGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145256.2-822s1c1
Sequence:CCGGCAGCAACGTGATTCTCCTTGACTCGAGTCAAGGAGAATCACGTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145256
LRRC25 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 25
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145256.2-1424s21c1
Sequence:CCGGCTCACCCTTCAGAGGACAATGCTCGAGCATTGTCCTCTGAAGGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145256.2-758s21c1
Sequence:CCGGGTGCCACGTGCCTGAATTTCACTCGAGTGAAATTCAGGCACGTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145256.2-902s21c1
Sequence:CCGGTTGAGGTCCTGAACGTGCTACCTCGAGGTAGCACGTTCAGGACCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145256.2-1428s1c1
Sequence:CCGGCCCTTCAGAGGACAATGACTTCTCGAGAAGTCATTGTCCTCTGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145256.2-1491s1c1
Sequence:CCGGCTACTGTAACCTGCAGTCACTCTCGAGAGTGACTGCAGGTTACAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145256.2-829s1c1
Sequence:CCGGGTGATTCTCCTTGACCTGTCTCTCGAGAGACAGGTCAAGGAGAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145256.2-1659s1c1
Sequence:CCGGGAATGGGTACAGGAAAGGATTCTCGAGAATCCTTTCCTGTACCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145256.2-1665s1c1
Sequence:CCGGGTACAGGAAAGGATTGTCCTTCTCGAGAAGGACAATCCTTTCCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145256.2-1452s1c1
Sequence:CCGGCATCAACTACAAGGACATCGACTCGAGTCGATGTCCTTGTAGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145256.2-865s1c1
Sequence:CCGGGAGCTTCCAGTGACCTTCTTTCTCGAGAAAGAAGGTCACTGGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145256.2-822s1c1
Sequence:CCGGCAGCAACGTGATTCTCCTTGACTCGAGTCAAGGAGAATCACGTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145256
LRRC25 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 25
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145256.2-1424s21c1
Sequence:CCGGCTCACCCTTCAGAGGACAATGCTCGAGCATTGTCCTCTGAAGGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145256.2-758s21c1
Sequence:CCGGGTGCCACGTGCCTGAATTTCACTCGAGTGAAATTCAGGCACGTGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145256.2-902s21c1
Sequence:CCGGTTGAGGTCCTGAACGTGCTACCTCGAGGTAGCACGTTCAGGACCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145256.2-1428s1c1
Sequence:CCGGCCCTTCAGAGGACAATGACTTCTCGAGAAGTCATTGTCCTCTGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145256.2-1491s1c1
Sequence:CCGGCTACTGTAACCTGCAGTCACTCTCGAGAGTGACTGCAGGTTACAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145256.2-829s1c1
Sequence:CCGGGTGATTCTCCTTGACCTGTCTCTCGAGAGACAGGTCAAGGAGAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145256.2-1659s1c1
Sequence:CCGGGAATGGGTACAGGAAAGGATTCTCGAGAATCCTTTCCTGTACCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145256.2-1665s1c1
Sequence:CCGGGTACAGGAAAGGATTGTCCTTCTCGAGAAGGACAATCCTTTCCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145256.2-1452s1c1
Sequence:CCGGCATCAACTACAAGGACATCGACTCGAGTCGATGTCCTTGTAGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145256.2-865s1c1
Sequence:CCGGGAGCTTCCAGTGACCTTCTTTCTCGAGAAAGAAGGTCACTGGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145256.2-822s1c1
Sequence:CCGGCAGCAACGTGATTCTCCTTGACTCGAGTCAAGGAGAATCACGTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153074
LRRC25 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 25
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153074.3-253s1c1
Sequence:CCGGCACAAGTCAGGAAGTCAAGATCTCGAGATCTTGACTTCCTGACTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-239s21c1
Sequence:CCGGTGTTGGCCCTGCTTCACAAGTCTCGAGACTTGTGAAGCAGGGCCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-1045s21c1
Sequence:CCGGTCTCAGCCCGTCTATTGCAACCTCGAGGTTGCAATAGACGGGCTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-926s21c1
Sequence:CCGGTGGATTATGAGAATGTCTTTACTCGAGTAAAGACATTCTCATAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-304s21c1
Sequence:CCGGGACTGGACTCAGACATTTAATCTCGAGATTAAATGTCTGAGTCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-394s21c1
Sequence:CCGGCAAGTCCTGGACCTGTCTAAGCTCGAGCTTAGACAGGTCCAGGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153074.2-924s1c1
Sequence:CCGGCAATGGATTATGAGAATGTCTCTCGAGAGACATTCTCATAATCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153074
LRRC25 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 25
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153074.3-253s1c1
Sequence:CCGGCACAAGTCAGGAAGTCAAGATCTCGAGATCTTGACTTCCTGACTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-239s21c1
Sequence:CCGGTGTTGGCCCTGCTTCACAAGTCTCGAGACTTGTGAAGCAGGGCCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-1045s21c1
Sequence:CCGGTCTCAGCCCGTCTATTGCAACCTCGAGGTTGCAATAGACGGGCTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-926s21c1
Sequence:CCGGTGGATTATGAGAATGTCTTTACTCGAGTAAAGACATTCTCATAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-304s21c1
Sequence:CCGGGACTGGACTCAGACATTTAATCTCGAGATTAAATGTCTGAGTCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-394s21c1
Sequence:CCGGCAAGTCCTGGACCTGTCTAAGCTCGAGCTTAGACAGGTCCAGGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153074.2-924s1c1
Sequence:CCGGCAATGGATTATGAGAATGTCTCTCGAGAGACATTCTCATAATCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153074
LRRC25 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 25
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153074.3-253s1c1
Sequence:CCGGCACAAGTCAGGAAGTCAAGATCTCGAGATCTTGACTTCCTGACTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-239s21c1
Sequence:CCGGTGTTGGCCCTGCTTCACAAGTCTCGAGACTTGTGAAGCAGGGCCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-1045s21c1
Sequence:CCGGTCTCAGCCCGTCTATTGCAACCTCGAGGTTGCAATAGACGGGCTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-926s21c1
Sequence:CCGGTGGATTATGAGAATGTCTTTACTCGAGTAAAGACATTCTCATAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-304s21c1
Sequence:CCGGGACTGGACTCAGACATTTAATCTCGAGATTAAATGTCTGAGTCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153074.3-394s21c1
Sequence:CCGGCAAGTCCTGGACCTGTCTAAGCTCGAGCTTAGACAGGTCCAGGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153074.2-924s1c1
Sequence:CCGGCAATGGATTATGAGAATGTCTCTCGAGAGACATTCTCATAATCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)