EMAIL THIS PAGE TO A FRIEND

LRRC26

leucine rich repeat containing 26

44 Gene Product Result for
Synonyms: CAPC bA350O14.10
UniProtKB ID: Q2I0M4, B9EIR7, C3RUL3, Q5VSG2
Gene ID:
Mouse(227618) leucine rich repeat containing 26
Rat(311803) leucine rich repeat containing 26
chicken(427776) leucine rich repeat containing 26
domestic cat(101082273) leucine rich repeat containing 26
cow(100300008) leucine rich repeat containing 26
dog(606959) leucine rich repeat containing 26
chicken(101667983) leucine rich repeat containing 26
chicken(101749800) leucine rich repeat containing 26
domestic guinea pig(100715428) leucine rich repeat containing 26
naked mole-rat(101719367) leucine rich repeat containing 26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013653 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013653 Rosetta Predictions human pricing
NM_001014053 Rosetta Predictions rat pricing
NM_146117 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157331 predicted 417
2 SASI_Hs01_00157332 predicted 679
3 SASI_Hs01_00157333 predicted 387
4 SASI_Hs01_00157334 predicted 515
5 SASI_Hs01_00157335 predicted 521
6 SASI_Hs01_00157336 predicted 470
7 SASI_Hs01_00157337 predicted 681
8 SASI_Hs01_00157338 predicted 394
9 SASI_Hs01_00157339 predicted 526
10 SASI_Hs01_00157340 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090793 predicted 402
2 SASI_Rn01_00090794 predicted 1025
3 SASI_Rn01_00090795 predicted 945
4 SASI_Rn01_00090796 predicted 905
5 SASI_Rn01_00090797 predicted 515
6 SASI_Rn01_00090798 predicted 767
7 SASI_Rn01_00090799 predicted 587
8 SASI_Rn01_00090800 predicted 520
9 SASI_Rn01_00090801 predicted 674
10 SASI_Rn01_00090802 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122142 predicted 811
2 SASI_Mm01_00122143 predicted 558
3 SASI_Mm01_00122144 predicted 489
4 SASI_Mm02_00341780 predicted 260
5 SASI_Mm01_00122145 predicted 584
6 SASI_Mm01_00122146 predicted 669
7 SASI_Mm01_00122147 predicted 308
8 SASI_Mm01_00122148 predicted 314
9 SASI_Mm01_00122150 predicted 330
10 SASI_Mm01_00122151 predicted 877
11 SASI_Mm01_00122149 predicted 793
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013653
LRRC26 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 26
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-526s21c1
Sequence:CCGGGCGCTGCGCAACCTCTCATTGCTCGAGCAATGAGAGGTTGCGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-140s21c1
Sequence:CCGGTGTTGCTGCTGCTGTCGCCTTCTCGAGAAGGCGACAGCAGCAGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-492s21c1
Sequence:CCGGAGCACTGGCACCAGGGACTTTCTCGAGAAAGTCCCTGGTGCCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-609s21c1
Sequence:CCGGACTCAGCCTGCAGGACAACGACTCGAGTCGTTGTCCTGCAGGCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013653
LRRC26 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 26
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-526s21c1
Sequence:CCGGGCGCTGCGCAACCTCTCATTGCTCGAGCAATGAGAGGTTGCGCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-140s21c1
Sequence:CCGGTGTTGCTGCTGCTGTCGCCTTCTCGAGAAGGCGACAGCAGCAGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-492s21c1
Sequence:CCGGAGCACTGGCACCAGGGACTTTCTCGAGAAAGTCCCTGGTGCCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-609s21c1
Sequence:CCGGACTCAGCCTGCAGGACAACGACTCGAGTCGTTGTCCTGCAGGCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013653
LRRC26 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 26
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-526s21c1
Sequence:CCGGGCGCTGCGCAACCTCTCATTGCTCGAGCAATGAGAGGTTGCGCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-140s21c1
Sequence:CCGGTGTTGCTGCTGCTGTCGCCTTCTCGAGAAGGCGACAGCAGCAGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-492s21c1
Sequence:CCGGAGCACTGGCACCAGGGACTTTCTCGAGAAAGTCCCTGGTGCCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013653.2-609s21c1
Sequence:CCGGACTCAGCCTGCAGGACAACGACTCGAGTCGTTGTCCTGCAGGCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146117
LRRC26 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-851s1c1
Sequence:CCGGCGGTCTCTTTCCTTGCTAGTTCTCGAGAACTAGCAAGGAAAGAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-472s1c1
Sequence:CCGGGCGCTTAGTTTCCTCTCCCTACTCGAGTAGGGAGAGGAAACTAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-175s1c1
Sequence:CCGGGAGGCATGTTCATGTTCACTACTCGAGTAGTGAACATGAACATGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-952s1c1
Sequence:CCGGCACTTACTAAGGAGACAGCTACTCGAGTAGCTGTCTCCTTAGTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146117.1-1074s1c1
Sequence:CCGGCCTCCGTACTTTGAGAACTCTCTCGAGAGAGTTCTCAAAGTACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146117
LRRC26 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-851s1c1
Sequence:CCGGCGGTCTCTTTCCTTGCTAGTTCTCGAGAACTAGCAAGGAAAGAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-472s1c1
Sequence:CCGGGCGCTTAGTTTCCTCTCCCTACTCGAGTAGGGAGAGGAAACTAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-175s1c1
Sequence:CCGGGAGGCATGTTCATGTTCACTACTCGAGTAGTGAACATGAACATGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-952s1c1
Sequence:CCGGCACTTACTAAGGAGACAGCTACTCGAGTAGCTGTCTCCTTAGTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146117.1-1074s1c1
Sequence:CCGGCCTCCGTACTTTGAGAACTCTCTCGAGAGAGTTCTCAAAGTACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146117
LRRC26 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-851s1c1
Sequence:CCGGCGGTCTCTTTCCTTGCTAGTTCTCGAGAACTAGCAAGGAAAGAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-472s1c1
Sequence:CCGGGCGCTTAGTTTCCTCTCCCTACTCGAGTAGGGAGAGGAAACTAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-175s1c1
Sequence:CCGGGAGGCATGTTCATGTTCACTACTCGAGTAGTGAACATGAACATGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146117.1-952s1c1
Sequence:CCGGCACTTACTAAGGAGACAGCTACTCGAGTAGCTGTCTCCTTAGTAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146117.1-1074s1c1
Sequence:CCGGCCTCCGTACTTTGAGAACTCTCTCGAGAGAGTTCTCAAAGTACGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)