EMAIL THIS PAGE TO A FRIEND

LRRC27

leucine rich repeat containing 27

66 Gene Product Result for
Gene ID:
Mouse(76612) leucine rich repeat containing 27
Rat(499281) leucine rich repeat containing 27
sheep(101109500) leucine rich repeat containing 27
naked mole-rat(101706918) leucine rich repeat containing 27
domestic guinea pig(100730142) leucine rich repeat containing 27
domestic cat(101087354) leucine rich repeat containing 27
cow(614529) leucine rich repeat containing 27
dog(607648) leucine rich repeat containing 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030626 Rosetta Predictions human pricing
NM_001113789 Rosetta Predictions rat pricing
NM_027164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358186 predicted 1068
2 SASI_Hs01_00045592 predicted 1554
3 SASI_Hs01_00045593 predicted 1353
4 SASI_Hs02_00358187 predicted 1397
5 SASI_Hs02_00358188 predicted 1533
6 SASI_Hs01_00045594 predicted 519
7 SASI_Hs01_00045595 predicted 336
8 SASI_Hs01_00045596 predicted 959
9 SASI_Hs01_00045597 predicted 897
10 SASI_Hs01_00045599 predicted 1302
11 SASI_Hs01_00045598 predicted 994
12 SASI_Hs01_00045600 predicted 671
13 SASI_Hs01_00045601 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252143 predicted 431
2 SASI_Rn02_00252144 predicted 520
3 SASI_Rn02_00252145 predicted 669
4 SASI_Rn02_00252146 predicted 481
5 SASI_Rn02_00252147 predicted 965
6 SASI_Rn02_00252148 predicted 912
7 SASI_Rn02_00252149 predicted 531
8 SASI_Rn02_00252150 predicted 761
9 SASI_Rn02_00252151 predicted 756
10 SASI_Rn02_00252152 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070193 predicted 1190
2 SASI_Mm02_00331683 predicted 1530
3 SASI_Mm01_00070194 predicted 565
4 SASI_Mm01_00070195 predicted 972
5 SASI_Mm01_00070196 predicted 1559
6 SASI_Mm01_00070197 predicted 376
7 SASI_Mm01_00070198 predicted 924
8 SASI_Mm01_00070199 predicted 576
9 SASI_Mm01_00070200 predicted 1501
10 SASI_Mm01_00070201 predicted 1102
11 SASI_Mm01_00070202 predicted 990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030626
LRRC27 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 27
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-1037s21c1
Sequence:CCGGAGCTCTTGACGAGGGAATTACCTCGAGGTAATTCCCTCGTCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030626.1-310s1c1
Sequence:CCGGCTTCAACAATTGCATCTGCAACTCGAGTTGCAGATGCAATTGTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-487s21c1
Sequence:CCGGCTCCGGTACAATAGAATTAAACTCGAGTTTAATTCTATTGTACCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-368s21c1
Sequence:CCGGGCCGTTTGGAGGAGGTCTTTACTCGAGTAAAGACCTCCTCCAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030626.2-2850s21c1
Sequence:CCGGTTCGTACTTTCCGAGAGTTTACTCGAGTAAACTCTCGGAAAGTACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-1762s21c1
Sequence:CCGGTCAGGAAATGTTCGCAGATACCTCGAGGTATCTGCGAACATTTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030626.1-1450s1c1
Sequence:CCGGCGTGAGCAAAGAAGATTCCATCTCGAGATGGAATCTTCTTTGCTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030626.1-732s1c1
Sequence:CCGGGTCTAACCAAGGAGCTGTGAACTCGAGTTCACAGCTCCTTGGTTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030626
LRRC27 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 27
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-1037s21c1
Sequence:CCGGAGCTCTTGACGAGGGAATTACCTCGAGGTAATTCCCTCGTCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030626.1-310s1c1
Sequence:CCGGCTTCAACAATTGCATCTGCAACTCGAGTTGCAGATGCAATTGTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-487s21c1
Sequence:CCGGCTCCGGTACAATAGAATTAAACTCGAGTTTAATTCTATTGTACCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-368s21c1
Sequence:CCGGGCCGTTTGGAGGAGGTCTTTACTCGAGTAAAGACCTCCTCCAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030626.2-2850s21c1
Sequence:CCGGTTCGTACTTTCCGAGAGTTTACTCGAGTAAACTCTCGGAAAGTACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-1762s21c1
Sequence:CCGGTCAGGAAATGTTCGCAGATACCTCGAGGTATCTGCGAACATTTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030626.1-1450s1c1
Sequence:CCGGCGTGAGCAAAGAAGATTCCATCTCGAGATGGAATCTTCTTTGCTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030626.1-732s1c1
Sequence:CCGGGTCTAACCAAGGAGCTGTGAACTCGAGTTCACAGCTCCTTGGTTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030626
LRRC27 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 27
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-1037s21c1
Sequence:CCGGAGCTCTTGACGAGGGAATTACCTCGAGGTAATTCCCTCGTCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030626.1-310s1c1
Sequence:CCGGCTTCAACAATTGCATCTGCAACTCGAGTTGCAGATGCAATTGTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-487s21c1
Sequence:CCGGCTCCGGTACAATAGAATTAAACTCGAGTTTAATTCTATTGTACCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-368s21c1
Sequence:CCGGGCCGTTTGGAGGAGGTCTTTACTCGAGTAAAGACCTCCTCCAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030626.2-2850s21c1
Sequence:CCGGTTCGTACTTTCCGAGAGTTTACTCGAGTAAACTCTCGGAAAGTACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030626.2-1762s21c1
Sequence:CCGGTCAGGAAATGTTCGCAGATACCTCGAGGTATCTGCGAACATTTCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030626.1-1450s1c1
Sequence:CCGGCGTGAGCAAAGAAGATTCCATCTCGAGATGGAATCTTCTTTGCTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030626.1-732s1c1
Sequence:CCGGGTCTAACCAAGGAGCTGTGAACTCGAGTTCACAGCTCCTTGGTTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027164
VALIDATED
LRRC27 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027164.1-2056s1c1
Sequence:CCGGCCTGAGGCTATAGAAGGTTTACTCGAGTAAACCTTCTATAGCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027164.1-1497s1c1
Sequence:CCGGCACATAGTAACATGATGGCATCTCGAGATGCCATCATGTTACTATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027164.1-716s1c1
Sequence:CCGGCTAGAACGAAATCCTATCAAACTCGAGTTTGATAGGATTTCGTTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027164.1-1561s1c1
Sequence:CCGGGCCAGTAAGTCCATTTGGGAACTCGAGTTCCCAAATGGACTTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027164.1-1220s1c1
Sequence:CCGGGCGCTAAACGTCAAGGAGAAACTCGAGTTTCTCCTTGACGTTTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027164
VALIDATED
LRRC27 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027164.1-2056s1c1
Sequence:CCGGCCTGAGGCTATAGAAGGTTTACTCGAGTAAACCTTCTATAGCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027164.1-1497s1c1
Sequence:CCGGCACATAGTAACATGATGGCATCTCGAGATGCCATCATGTTACTATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027164.1-716s1c1
Sequence:CCGGCTAGAACGAAATCCTATCAAACTCGAGTTTGATAGGATTTCGTTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027164.1-1561s1c1
Sequence:CCGGGCCAGTAAGTCCATTTGGGAACTCGAGTTCCCAAATGGACTTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027164.1-1220s1c1
Sequence:CCGGGCGCTAAACGTCAAGGAGAAACTCGAGTTTCTCCTTGACGTTTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027164
VALIDATED
LRRC27 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027164.1-2056s1c1
Sequence:CCGGCCTGAGGCTATAGAAGGTTTACTCGAGTAAACCTTCTATAGCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027164.1-1497s1c1
Sequence:CCGGCACATAGTAACATGATGGCATCTCGAGATGCCATCATGTTACTATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027164.1-716s1c1
Sequence:CCGGCTAGAACGAAATCCTATCAAACTCGAGTTTGATAGGATTTCGTTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027164.1-1561s1c1
Sequence:CCGGGCCAGTAAGTCCATTTGGGAACTCGAGTTCCCAAATGGACTTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027164.1-1220s1c1
Sequence:CCGGGCGCTAAACGTCAAGGAGAAACTCGAGTTTCTCCTTGACGTTTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)