EMAIL THIS PAGE TO A FRIEND

LRRC28

leucine rich repeat containing 28

104 Gene Product Result for
UniProtKB ID: Q86X40, A8KA22, Q6UY49, Q6ZSS6
Gene ID:
Mouse(67867) leucine rich repeat containing 28
Rat(361588) leucine rich repeat containing 28
Zebrafish(555592) leucine rich repeat containing 28
cow(532910) leucine rich repeat containing 28
domestic cat(101098229) leucine rich repeat containing 28
dog(479023) leucine rich repeat containing 28
chicken(415512) leucine rich repeat containing 28
domestic guinea pig(100735957) leucine rich repeat containing 28
naked mole-rat(101707481) leucine rich repeat containing 28
sheep(101117793) leucine rich repeat containing 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144598 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089281 MISSION® esiRNA esiRNA human LRRC28 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144598 Rosetta Predictions human pricing
NM_001108486 Rosetta Predictions rat pricing
NM_175124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364394 predicted 450
2 SASI_Hs01_00148182 predicted 716
3 SASI_Hs01_00148183 predicted 976
4 SASI_Hs01_00148184 predicted 579
5 SASI_Hs02_00364395 predicted 251
6 SASI_Hs01_00148186 predicted 348
7 SASI_Hs01_00148187 predicted 1109
8 SASI_Hs01_00148188 predicted 417
9 SASI_Hs01_00148189 predicted 643
10 SASI_Hs01_00148190 predicted 268
11 SASI_Hs01_00148185 predicted 356
12 SASI_Hs01_00148191 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239119 predicted 214
2 SASI_Rn02_00239120 predicted 458
3 SASI_Rn02_00239121 predicted 327
4 SASI_Rn02_00239122 predicted 1206
5 SASI_Rn02_00239123 predicted 525
6 SASI_Rn02_00239124 predicted 1132
7 SASI_Rn02_00239125 predicted 374
8 SASI_Rn02_00239126 predicted 1027
9 SASI_Rn02_00239127 predicted 766
10 SASI_Rn02_00239128 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118322 predicted 1160
2 SASI_Mm02_00345736 predicted 401
3 SASI_Mm02_00345737 predicted 685
4 SASI_Mm01_00118323 predicted 321
5 SASI_Mm01_00118325 predicted 1066
6 SASI_Mm01_00118326 predicted 1075
7 SASI_Mm02_00345738 predicted 417
8 SASI_Mm01_00118328 predicted 696
9 SASI_Mm01_00118329 predicted 776
10 SASI_Mm01_00118330 predicted 471
11 SASI_Mm01_00118324 predicted 698
12 SASI_Mm01_00118327 predicted 310
13 SASI_Mm01_00118331 predicted 1090
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175124
LRRC28 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 28
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195923    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175124.3-1815s1c1
Sequence:CCGGCCTCTGGAAACTTCCTGTCTTCTCGAGAAGACAGGAAGTTTCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-742s1c1
Sequence:CCGGGTACGTGTATGTGGATAACAACTCGAGTTGTTATCCACATACACGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-739s1c1
Sequence:CCGGGCAGTACGTGTATGTGGATAACTCGAGTTATCCACATACACGTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-463s1c1
Sequence:CCGGGCGTCATCTTCGATTAGCTAACTCGAGTTAGCTAATCGAAGATGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-1085s1c1
Sequence:CCGGCCCATGTTTACCTTCGTCTATCTCGAGATAGACGAAGGTAAACATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175124.4-2270s1c1
Sequence:CCGGCTCTGTTTACTGGTATGATTTCTCGAGAAATCATACCAGTAAACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175124.4-414s1c1
Sequence:CCGGCAATGCCTTAGAGATCGTTTGCTCGAGCAAACGATCTCTAAGGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175124.4-688s1c1
Sequence:CCGGGGAAACCATCTTGCATCTTTGCTCGAGCAAAGATGCAAGATGGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175124
LRRC28 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 28
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195923    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175124.3-1815s1c1
Sequence:CCGGCCTCTGGAAACTTCCTGTCTTCTCGAGAAGACAGGAAGTTTCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-742s1c1
Sequence:CCGGGTACGTGTATGTGGATAACAACTCGAGTTGTTATCCACATACACGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-739s1c1
Sequence:CCGGGCAGTACGTGTATGTGGATAACTCGAGTTATCCACATACACGTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-463s1c1
Sequence:CCGGGCGTCATCTTCGATTAGCTAACTCGAGTTAGCTAATCGAAGATGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-1085s1c1
Sequence:CCGGCCCATGTTTACCTTCGTCTATCTCGAGATAGACGAAGGTAAACATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175124.4-2270s1c1
Sequence:CCGGCTCTGTTTACTGGTATGATTTCTCGAGAAATCATACCAGTAAACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175124.4-414s1c1
Sequence:CCGGCAATGCCTTAGAGATCGTTTGCTCGAGCAAACGATCTCTAAGGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175124.4-688s1c1
Sequence:CCGGGGAAACCATCTTGCATCTTTGCTCGAGCAAAGATGCAAGATGGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175124
LRRC28 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 28
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195923    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175124.3-1815s1c1
Sequence:CCGGCCTCTGGAAACTTCCTGTCTTCTCGAGAAGACAGGAAGTTTCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-742s1c1
Sequence:CCGGGTACGTGTATGTGGATAACAACTCGAGTTGTTATCCACATACACGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-739s1c1
Sequence:CCGGGCAGTACGTGTATGTGGATAACTCGAGTTATCCACATACACGTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-463s1c1
Sequence:CCGGGCGTCATCTTCGATTAGCTAACTCGAGTTAGCTAATCGAAGATGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175124.3-1085s1c1
Sequence:CCGGCCCATGTTTACCTTCGTCTATCTCGAGATAGACGAAGGTAAACATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216071    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175124.4-2270s1c1
Sequence:CCGGCTCTGTTTACTGGTATGATTTCTCGAGAAATCATACCAGTAAACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175124.4-414s1c1
Sequence:CCGGCAATGCCTTAGAGATCGTTTGCTCGAGCAAACGATCTCTAAGGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175124.4-688s1c1
Sequence:CCGGGGAAACCATCTTGCATCTTTGCTCGAGCAAAGATGCAAGATGGTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144598
VALIDATED
LRRC28 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 28
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-1115s1c1
Sequence:CCGGGCCTATGTTTACCATCGTCTACTCGAGTAGACGATGGTAAACATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-1104s1c1
Sequence:CCGGCGGTGTAGTGAGCCTATGTTTCTCGAGAAACATAGGCTCACTACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-489s1c1
Sequence:CCGGGCTTTACGTCATCTTCGATTACTCGAGTAATCGAAGATGACGTAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-1312s1c1
Sequence:CCGGCCAGTCCAGCACACTCTTCCACTCGAGTGGAAGAGTGTGCTGGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-786s1c1
Sequence:CCGGGATAACAACATTCACCTGAAACTCGAGTTTCAGGTGAATGTTGTTATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-422s21c1
Sequence:CCGGACTCCAATGTCTGGATCTTAGCTCGAGCTAAGATCCAGACATTGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-637s21c1
Sequence:CCGGACCTCACTGTGGACCGAAATCCTCGAGGATTTCGGTCCACAGTGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-1242s21c1
Sequence:CCGGTTTGACCTGCTGAGTTGATAACTCGAGTTATCAACTCAGCAGGTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-813s21c1
Sequence:CCGGCCATCTTATCTGTACAATAAACTCGAGTTTATTGTACAGATAAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-362s21c1
Sequence:CCGGACTATACCTGCACTCAAATAACTCGAGTTATTTGAGTGCAGGTATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-582s21c1
Sequence:CCGGACCAATCGTTTGCTAACTTTACTCGAGTAAAGTTAGCAAACGATTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144598
VALIDATED
LRRC28 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 28
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-1115s1c1
Sequence:CCGGGCCTATGTTTACCATCGTCTACTCGAGTAGACGATGGTAAACATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-1104s1c1
Sequence:CCGGCGGTGTAGTGAGCCTATGTTTCTCGAGAAACATAGGCTCACTACACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-489s1c1
Sequence:CCGGGCTTTACGTCATCTTCGATTACTCGAGTAATCGAAGATGACGTAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-1312s1c1
Sequence:CCGGCCAGTCCAGCACACTCTTCCACTCGAGTGGAAGAGTGTGCTGGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-786s1c1
Sequence:CCGGGATAACAACATTCACCTGAAACTCGAGTTTCAGGTGAATGTTGTTATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-422s21c1
Sequence:CCGGACTCCAATGTCTGGATCTTAGCTCGAGCTAAGATCCAGACATTGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-637s21c1
Sequence:CCGGACCTCACTGTGGACCGAAATCCTCGAGGATTTCGGTCCACAGTGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-1242s21c1
Sequence:CCGGTTTGACCTGCTGAGTTGATAACTCGAGTTATCAACTCAGCAGGTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-813s21c1
Sequence:CCGGCCATCTTATCTGTACAATAAACTCGAGTTTATTGTACAGATAAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-362s21c1
Sequence:CCGGACTATACCTGCACTCAAATAACTCGAGTTATTTGAGTGCAGGTATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-582s21c1
Sequence:CCGGACCAATCGTTTGCTAACTTTACTCGAGTAAAGTTAGCAAACGATTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144598
VALIDATED
LRRC28 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 28
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-1115s1c1
Sequence:CCGGGCCTATGTTTACCATCGTCTACTCGAGTAGACGATGGTAAACATAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-1104s1c1
Sequence:CCGGCGGTGTAGTGAGCCTATGTTTCTCGAGAAACATAGGCTCACTACACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-489s1c1
Sequence:CCGGGCTTTACGTCATCTTCGATTACTCGAGTAATCGAAGATGACGTAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-1312s1c1
Sequence:CCGGCCAGTCCAGCACACTCTTCCACTCGAGTGGAAGAGTGTGCTGGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_144598.2-786s1c1
Sequence:CCGGGATAACAACATTCACCTGAAACTCGAGTTTCAGGTGAATGTTGTTATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-422s21c1
Sequence:CCGGACTCCAATGTCTGGATCTTAGCTCGAGCTAAGATCCAGACATTGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-637s21c1
Sequence:CCGGACCTCACTGTGGACCGAAATCCTCGAGGATTTCGGTCCACAGTGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-1242s21c1
Sequence:CCGGTTTGACCTGCTGAGTTGATAACTCGAGTTATCAACTCAGCAGGTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-813s21c1
Sequence:CCGGCCATCTTATCTGTACAATAAACTCGAGTTTATTGTACAGATAAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-362s21c1
Sequence:CCGGACTATACCTGCACTCAAATAACTCGAGTTATTTGAGTGCAGGTATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144598.2-582s21c1
Sequence:CCGGACCAATCGTTTGCTAACTTTACTCGAGTAAAGTTAGCAAACGATTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)