EMAIL THIS PAGE TO A FRIEND

LRRC2

leucine rich repeat containing 2

140 Gene Product Result for
UniProtKB ID: Q9BYS8, B2RDQ7, Q96LT5
Gene ID:
Human(79442) Summary: This gene encodes a member of the leucine-rich repeat-containing family of proteins, which function in diverse biological pathways. This family member may possibly be a nuclear protein. Similarity to the RAS suppressor protein, as well as expression down-regulation observed in tumor cells, suggests that it may function as a tumor suppressor. The gene is located in the chromosome 3 common eliminated region 1 (C3CER1), a 1.4 Mb region that is commonly deleted in diverse tumors. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Sep 2011]
Mouse(74249) leucine rich repeat containing 2
Rat(301033) leucine rich repeat containing 2
sheep(101116941) leucine rich repeat containing 2
naked mole-rat(101721631) leucine rich repeat containing 2
domestic guinea pig(100717219) leucine rich repeat containing 2
Zebrafish(557308) leucine rich repeat containing 2
domestic cat(101084009) leucine rich repeat containing 2
cow(541113) leucine rich repeat containing 2
Horse(100065243) leucine rich repeat containing 2
dog(476647) leucine rich repeat containing 2
chicken(426202) leucine rich repeat containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024512 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024512 Rosetta Predictions human pricing
NM_024750 Rosetta Predictions human pricing
NM_001012001 Rosetta Predictions rat pricing
NM_028838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133569 predicted 808
2 SASI_Hs01_00133570 predicted 353
3 SASI_Hs01_00133571 predicted 853
4 SASI_Hs01_00133572 predicted 850
5 SASI_Hs01_00133573 predicted 1010
6 SASI_Hs01_00133574 predicted 916
7 SASI_Hs01_00133575 predicted 992
8 SASI_Hs01_00133576 predicted 1100
9 SASI_Hs02_00356781 predicted 798
10 SASI_Hs01_00133577 predicted 1053
11 SASI_Hs01_00133578 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104718 predicted 803
2 SASI_Hs01_00104719 predicted 353
3 SASI_Hs01_00104720 predicted 855
4 SASI_Hs01_00104721 predicted 851
5 SASI_Hs01_00104722 predicted 1015
6 SASI_Hs01_00104723 predicted 917
7 SASI_Hs01_00104725 predicted 1101
8 SASI_Hs02_00357236 predicted 803
9 SASI_Hs01_00104726 predicted 1053
10 SASI_Hs01_00104727 predicted 820
11 SASI_Hs01_00104724 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200050 predicted 1148
2 SASI_Rn02_00200051 predicted 207
3 SASI_Rn02_00200052 predicted 248
4 SASI_Rn02_00200053 predicted 1137
5 SASI_Rn02_00200054 predicted 328
6 SASI_Rn02_00200055 predicted 1151
7 SASI_Rn02_00200056 predicted 478
8 SASI_Rn02_00200057 predicted 1255
9 SASI_Rn02_00200058 predicted 459
10 SASI_Rn02_00200059 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334470 predicted 1323
2 SASI_Mm02_00334471 predicted 886
3 SASI_Mm02_00334472 predicted 1236
4 SASI_Mm02_00334473 predicted 1339
5 SASI_Mm02_00334474 predicted 792
6 SASI_Mm02_00334475 predicted 792
7 SASI_Mm02_00334476 predicted 459
8 SASI_Mm02_00334477 predicted 652
9 SASI_Mm02_00334478 predicted 1303
10 SASI_Mm02_00334479 predicted 1189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028838
LRRC2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028838.2-1096s21c1
Sequence:CCGGTGTGGACAATCCCATTGATAACTCGAGTTATCAATGGGATTGTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028838.2-3017s21c1
Sequence:CCGGGAGATAGAGCCTCGGTCAATACTCGAGTATTGACCGAGGCTCTATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028838.2-437s21c1
Sequence:CCGGGACAAACGGAGGAGTCCATTTCTCGAGAAATGGACTCCTCCGTTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028838.2-1219s21c1
Sequence:CCGGAGAAGCTGTTCCCAGTTATACCTCGAGGTATAACTGGGAACAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028838.1-540s1c1
Sequence:CCGGCAGTACCCTCATTCAGATCATCTCGAGATGATCTGAATGAGGGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028838.1-795s1c1
Sequence:CCGGGCAAGTTACATTTGTGGATATCTCGAGATATCCACAAATGTAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028838
LRRC2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028838.2-1096s21c1
Sequence:CCGGTGTGGACAATCCCATTGATAACTCGAGTTATCAATGGGATTGTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028838.2-3017s21c1
Sequence:CCGGGAGATAGAGCCTCGGTCAATACTCGAGTATTGACCGAGGCTCTATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028838.2-437s21c1
Sequence:CCGGGACAAACGGAGGAGTCCATTTCTCGAGAAATGGACTCCTCCGTTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028838.2-1219s21c1
Sequence:CCGGAGAAGCTGTTCCCAGTTATACCTCGAGGTATAACTGGGAACAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028838.1-540s1c1
Sequence:CCGGCAGTACCCTCATTCAGATCATCTCGAGATGATCTGAATGAGGGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028838.1-795s1c1
Sequence:CCGGGCAAGTTACATTTGTGGATATCTCGAGATATCCACAAATGTAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028838
LRRC2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028838.2-1096s21c1
Sequence:CCGGTGTGGACAATCCCATTGATAACTCGAGTTATCAATGGGATTGTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028838.2-3017s21c1
Sequence:CCGGGAGATAGAGCCTCGGTCAATACTCGAGTATTGACCGAGGCTCTATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028838.2-437s21c1
Sequence:CCGGGACAAACGGAGGAGTCCATTTCTCGAGAAATGGACTCCTCCGTTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028838.2-1219s21c1
Sequence:CCGGAGAAGCTGTTCCCAGTTATACCTCGAGGTATAACTGGGAACAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028838.1-540s1c1
Sequence:CCGGCAGTACCCTCATTCAGATCATCTCGAGATGATCTGAATGAGGGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028838.1-795s1c1
Sequence:CCGGGCAAGTTACATTTGTGGATATCTCGAGATATCCACAAATGTAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024512
LRRC2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1061s21c1
Sequence:CCGGGTCCTGCGGATGTCGAATTTGCTCGAGCAAATTCGACATCCGCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024512.3-1506s21c1
Sequence:CCGGACTATTCTCTGGAGCTATATACTCGAGTATATAGCTCCAGAGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1302s21c1
Sequence:CCGGGCCTTATGGACAATCCTATTGCTCGAGCAATAGGATTGTCCATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1363s21c1
Sequence:CCGGTGAACGGGATCGCCAACATTTCTCGAGAAATGTTGGCGATCCCGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1403s21c1
Sequence:CCGGGCCTATATTGAAGACCTTAAACTCGAGTTTAAGGTCTTCAATATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024512
LRRC2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1061s21c1
Sequence:CCGGGTCCTGCGGATGTCGAATTTGCTCGAGCAAATTCGACATCCGCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024512.3-1506s21c1
Sequence:CCGGACTATTCTCTGGAGCTATATACTCGAGTATATAGCTCCAGAGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1302s21c1
Sequence:CCGGGCCTTATGGACAATCCTATTGCTCGAGCAATAGGATTGTCCATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1363s21c1
Sequence:CCGGTGAACGGGATCGCCAACATTTCTCGAGAAATGTTGGCGATCCCGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1403s21c1
Sequence:CCGGGCCTATATTGAAGACCTTAAACTCGAGTTTAAGGTCTTCAATATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024512
LRRC2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1061s21c1
Sequence:CCGGGTCCTGCGGATGTCGAATTTGCTCGAGCAAATTCGACATCCGCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024512.3-1506s21c1
Sequence:CCGGACTATTCTCTGGAGCTATATACTCGAGTATATAGCTCCAGAGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1302s21c1
Sequence:CCGGGCCTTATGGACAATCCTATTGCTCGAGCAATAGGATTGTCCATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1363s21c1
Sequence:CCGGTGAACGGGATCGCCAACATTTCTCGAGAAATGTTGGCGATCCCGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024512.3-1403s21c1
Sequence:CCGGGCCTATATTGAAGACCTTAAACTCGAGTTTAAGGTCTTCAATATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)