EMAIL THIS PAGE TO A FRIEND

LRRC30

leucine rich repeat containing 30

51 Gene Product Result for
UniProtKB ID: A6NM36
Gene ID:
Mouse(240131) leucine rich repeat containing 30
Rat(301711) leucine rich repeat containing 30
Zebrafish(552944) leucine rich repeat containing 30
cow(527341) leucine rich repeat containing 30
domestic cat(101081258) leucine rich repeat containing 30
dog(490544) leucine rich repeat containing 30
chicken(769685) leucine rich repeat containing 30
sheep(101106733) leucine rich repeat containing 30
naked mole-rat(101707013) leucine rich repeat containing 30
domestic guinea pig(100719479) leucine rich repeat containing 30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_292678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_292678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_292678 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001105581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105581 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033340 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033340 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033340 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105581 Rosetta Predictions human pricing
XM_001054231 Rosetta Predictions rat pricing
XM_237538 Rosetta Predictions rat pricing
NM_001033340 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324611 predicted 422
2 SASI_Hs02_00324612 predicted 503
3 SASI_Hs02_00324613 predicted 494
4 SASI_Hs02_00324614 predicted 394
5 SASI_Hs02_00324615 predicted 202
6 SASI_Hs02_00324616 predicted 346
7 SASI_Hs02_00324617 predicted 646
8 SASI_Hs02_00324618 predicted 346
9 SASI_Hs02_00324619 predicted 200
10 SASI_Hs02_00324620 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275171 predicted 281
2 SASI_Rn02_00275172 predicted 274
3 SASI_Rn02_00275173 predicted 349
4 SASI_Rn02_00275174 predicted 396
5 SASI_Rn02_00275175 predicted 417
6 SASI_Rn02_00275176 predicted 645
7 SASI_Rn02_00275177 predicted 504
8 SASI_Rn02_00275178 predicted 613
9 SASI_Rn02_00275179 predicted 224
10 SASI_Rn02_00275180 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390999 predicted 282
2 SASI_Rn02_00391000 predicted 274
3 SASI_Rn02_00391001 predicted 345
4 SASI_Rn02_00391002 predicted 393
5 SASI_Rn02_00391003 predicted 425
6 SASI_Rn02_00391004 predicted 640
7 SASI_Rn02_00391005 predicted 508
8 SASI_Rn02_00391006 predicted 612
9 SASI_Rn02_00391007 predicted 230
10 SASI_Rn02_00391008 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288595 predicted 945
2 SASI_Mm01_00117388 predicted 306
3 SASI_Mm01_00117389 predicted 420
4 SASI_Mm01_00117390 predicted 1211
5 SASI_Mm01_00117392 predicted 202
6 SASI_Mm01_00117393 predicted 1164
7 SASI_Mm01_00117394 predicted 1188
8 SASI_Mm01_00117395 predicted 681
9 SASI_Mm01_00117396 predicted 871
10 SASI_Mm02_00288596 predicted 786
11 SASI_Mm01_00117387 predicted 948
12 SASI_Mm01_00117391 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_292678
LRRC30 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 30
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000186621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-711s1c1
Sequence:CCGGGAACCTCAACAACAATGACATCTCGAGATGTCATTGTTGTTGAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-513s1c1
Sequence:CCGGCAACAACTTCTTCGCGCACATCTCGAGATGTGCGCGAAGAAGTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-484s1c1
Sequence:CCGGCTCTCTAGACTGAGGAAGCTACTCGAGTAGCTTCCTCAGTCTAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-228s1c1
Sequence:CCGGCAATCTGTCTCACAACCAGCTCTCGAGAGCTGGTTGTGAGACAGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-168s1c1
Sequence:CCGGCACGAGAGGAATGACAGACATCTCGAGATGTCTGTCATTCCTCTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_292678
LRRC30 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 30
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000186621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-711s1c1
Sequence:CCGGGAACCTCAACAACAATGACATCTCGAGATGTCATTGTTGTTGAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-513s1c1
Sequence:CCGGCAACAACTTCTTCGCGCACATCTCGAGATGTGCGCGAAGAAGTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-484s1c1
Sequence:CCGGCTCTCTAGACTGAGGAAGCTACTCGAGTAGCTTCCTCAGTCTAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-228s1c1
Sequence:CCGGCAATCTGTCTCACAACCAGCTCTCGAGAGCTGGTTGTGAGACAGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-168s1c1
Sequence:CCGGCACGAGAGGAATGACAGACATCTCGAGATGTCTGTCATTCCTCTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_292678
LRRC30 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 30
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000186621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-711s1c1
Sequence:CCGGGAACCTCAACAACAATGACATCTCGAGATGTCATTGTTGTTGAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-513s1c1
Sequence:CCGGCAACAACTTCTTCGCGCACATCTCGAGATGTGCGCGAAGAAGTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-484s1c1
Sequence:CCGGCTCTCTAGACTGAGGAAGCTACTCGAGTAGCTTCCTCAGTCTAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-228s1c1
Sequence:CCGGCAATCTGTCTCACAACCAGCTCTCGAGAGCTGGTTGTGAGACAGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292678.2-168s1c1
Sequence:CCGGCACGAGAGGAATGACAGACATCTCGAGATGTCTGTCATTCCTCTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105581
LRRC30 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 30
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000425207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-206s21c1
Sequence:CCGGGCTTGTCCGAGGTCCAGAAACCTCGAGGTTTCTGGACCTCGGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-546s21c1
Sequence:CCGGGTTCTCCCTGAAGGAACTGATCTCGAGATCAGTTCCTTCAGGGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-782s21c1
Sequence:CCGGCCTGGAATCCCATGGACAAAGCTCGAGCTTTGTCCATGGGATTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-284s21c1
Sequence:CCGGGGATCGTGGTCCTGAACTTGTCTCGAGACAAGTTCAGGACCACGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105581
LRRC30 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 30
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000425207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-206s21c1
Sequence:CCGGGCTTGTCCGAGGTCCAGAAACCTCGAGGTTTCTGGACCTCGGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-546s21c1
Sequence:CCGGGTTCTCCCTGAAGGAACTGATCTCGAGATCAGTTCCTTCAGGGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-782s21c1
Sequence:CCGGCCTGGAATCCCATGGACAAAGCTCGAGCTTTGTCCATGGGATTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-284s21c1
Sequence:CCGGGGATCGTGGTCCTGAACTTGTCTCGAGACAAGTTCAGGACCACGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105581
LRRC30 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 30
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000425207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-206s21c1
Sequence:CCGGGCTTGTCCGAGGTCCAGAAACCTCGAGGTTTCTGGACCTCGGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-546s21c1
Sequence:CCGGGTTCTCCCTGAAGGAACTGATCTCGAGATCAGTTCCTTCAGGGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-782s21c1
Sequence:CCGGCCTGGAATCCCATGGACAAAGCTCGAGCTTTGTCCATGGGATTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105581.1-284s21c1
Sequence:CCGGGGATCGTGGTCCTGAACTTGTCTCGAGACAAGTTCAGGACCACGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033340
LRRC30 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 30
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-763s21c1
Sequence:CCGGCTAGCTTGCAGATCTTCATTGCTCGAGCAATGAAGATCTGCAAGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033340.2-1345s21c1
Sequence:CCGGTAGCTCTCAGTAACGTGAATGCTCGAGCATTCACGTTACTGAGAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-291s21c1
Sequence:CCGGAGCTTCAGTCTAGTCACTAAACTCGAGTTTAGTGACTAGACTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-417s21c1
Sequence:CCGGACCCGGATAGTGGTCCTAAACCTCGAGGTTTAGGACCACTATCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-643s21c1
Sequence:CCGGACCTTAGCAACAACTACTTTGCTCGAGCAAAGTAGTTGTTGCTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033340
LRRC30 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 30
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-763s21c1
Sequence:CCGGCTAGCTTGCAGATCTTCATTGCTCGAGCAATGAAGATCTGCAAGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033340.2-1345s21c1
Sequence:CCGGTAGCTCTCAGTAACGTGAATGCTCGAGCATTCACGTTACTGAGAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-291s21c1
Sequence:CCGGAGCTTCAGTCTAGTCACTAAACTCGAGTTTAGTGACTAGACTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-417s21c1
Sequence:CCGGACCCGGATAGTGGTCCTAAACCTCGAGGTTTAGGACCACTATCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-643s21c1
Sequence:CCGGACCTTAGCAACAACTACTTTGCTCGAGCAAAGTAGTTGTTGCTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033340
LRRC30 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 30
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-763s21c1
Sequence:CCGGCTAGCTTGCAGATCTTCATTGCTCGAGCAATGAAGATCTGCAAGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033340.2-1345s21c1
Sequence:CCGGTAGCTCTCAGTAACGTGAATGCTCGAGCATTCACGTTACTGAGAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-291s21c1
Sequence:CCGGAGCTTCAGTCTAGTCACTAAACTCGAGTTTAGTGACTAGACTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-417s21c1
Sequence:CCGGACCCGGATAGTGGTCCTAAACCTCGAGGTTTAGGACCACTATCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033340.2-643s21c1
Sequence:CCGGACCTTAGCAACAACTACTTTGCTCGAGCAAAGTAGTTGTTGCTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)