EMAIL THIS PAGE TO A FRIEND

LRRC31

leucine rich repeat containing 31

79 Gene Product Result for
UniProtKB ID: Q6UY01, B7ZL44, Q17RA3, Q8N848, Q9H5N5
Gene ID:
Mouse(320352) leucine rich repeat containing 31
Rat(310256) leucine rich repeat containing 31
domestic guinea pig(101787277) leucine rich repeat containing 31
naked mole-rat(101726664) leucine rich repeat containing 31
sheep(101113905) leucine rich repeat containing 31
chicken(424994) leucine rich repeat containing 31
dog(488153) leucine rich repeat containing 31
domestic cat(101097086) leucine rich repeat containing 31
cow(784330) leucine rich repeat containing 31
Horse(100063397) leucine rich repeat containing 31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024727 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125261 MISSION® esiRNA esiRNA human LRRC31 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024727 Rosetta Predictions human pricing
XM_001064981 Rosetta Predictions rat pricing
XM_226972 Rosetta Predictions rat pricing
XR_002334 Rosetta Predictions mouse pricing
XR_035308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128182 predicted 999
2 SASI_Hs01_00128183 predicted 1092
3 SASI_Hs01_00128184 predicted 330
4 SASI_Hs01_00128185 predicted 840
5 SASI_Hs01_00128186 predicted 783
6 SASI_Hs01_00128187 predicted 851
7 SASI_Hs02_00357198 predicted 1563
8 SASI_Hs01_00128189 predicted 994
9 SASI_Hs02_00357199 predicted 780
10 SASI_Hs02_00357200 predicted 664
11 SASI_Hs01_00128181 predicted 481
12 SASI_Hs01_00128188 predicted 950
13 SASI_Hs01_00128190 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312452 predicted 578
2 SASI_Rn02_00312453 predicted 827
3 SASI_Rn02_00312454 predicted 446
4 SASI_Rn02_00312455 predicted 791
5 SASI_Rn02_00312456 predicted 257
6 SASI_Rn02_00312457 predicted 491
7 SASI_Rn02_00312458 predicted 918
8 SASI_Rn02_00312459 predicted 1045
9 SASI_Rn02_00312460 predicted 918
10 SASI_Rn02_00312461 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383981 predicted 555
2 SASI_Rn02_00383982 predicted 801
3 SASI_Rn02_00383983 predicted 421
4 SASI_Rn02_00383984 predicted 764
5 SASI_Rn02_00383985 predicted 230
6 SASI_Rn02_00383986 predicted 465
7 SASI_Rn02_00383987 predicted 892
8 SASI_Rn02_00383988 predicted 1124
9 SASI_Rn02_00383989 predicted 1015
10 SASI_Rn02_00383990 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_002334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00452967 predicted 983
2 SASI_Mm02_00452968 predicted 387
3 SASI_Mm02_00452969 predicted 463
4 SASI_Mm02_00452970 predicted 1123
5 SASI_Mm02_00452971 predicted 861
6 SASI_Mm02_00452972 predicted 561
7 SASI_Mm02_00452973 predicted 284
8 SASI_Mm02_00452974 predicted 391
9 SASI_Mm02_00452975 predicted 1319
10 SASI_Mm02_00452976 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00481489 predicted 936
2 SASI_Mm02_00481490 predicted 341
3 SASI_Mm02_00481491 predicted 412
4 SASI_Mm02_00481492 predicted 1071
5 SASI_Mm02_00481493 predicted 811
6 SASI_Mm02_00481494 predicted 502
7 SASI_Mm02_00481495 predicted 224
8 SASI_Mm02_00481496 predicted 343
9 SASI_Mm02_00481497 predicted 1257
10 SASI_Mm02_00481498 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024727
LRRC31 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 31
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024727.1-1986s1c1
Sequence:CCGGGCTTTCCTCTTGCCCAGAAATCTCGAGATTTCTGGGCAAGAGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-380s1c1
Sequence:CCGGGCTGTCAACAAGTGTCTAGATCTCGAGATCTAGACACTTGTTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-1052s1c1
Sequence:CCGGCCAGCATTGAAGTCATTAGTTCTCGAGAACTAATGACTTCAATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-172s1c1
Sequence:CCGGCCAGACTTCAACTGTCAACAACTCGAGTTGTTGACAGTTGAAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-305s1c1
Sequence:CCGGCCTCTCAGTTCAGAAATGGAACTCGAGTTCCATTTCTGAACTGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024727.2-809s21c1
Sequence:CCGGCAGTATTGCTCAGGGATTAAACTCGAGTTTAATCCCTGAGCAATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024727.2-1522s21c1
Sequence:CCGGAGCTAATCGAGCTGGATATTACTCGAGTAATATCCAGCTCGATTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024727.1-1632s1c1
Sequence:CCGGCCTACTAAGCTACAAACCATTCTCGAGAATGGTTTGTAGCTTAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-521s1c1
Sequence:CCGGCTGATCCTTCAGAAGTTCCAACTCGAGTTGGAACTTCTGAAGGATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-875s1c1
Sequence:CCGGGTCATGCTAAAGCATCTACAACTCGAGTTGTAGATGCTTTAGCATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024727
LRRC31 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 31
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024727.1-1986s1c1
Sequence:CCGGGCTTTCCTCTTGCCCAGAAATCTCGAGATTTCTGGGCAAGAGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-380s1c1
Sequence:CCGGGCTGTCAACAAGTGTCTAGATCTCGAGATCTAGACACTTGTTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-1052s1c1
Sequence:CCGGCCAGCATTGAAGTCATTAGTTCTCGAGAACTAATGACTTCAATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-172s1c1
Sequence:CCGGCCAGACTTCAACTGTCAACAACTCGAGTTGTTGACAGTTGAAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-305s1c1
Sequence:CCGGCCTCTCAGTTCAGAAATGGAACTCGAGTTCCATTTCTGAACTGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024727.2-809s21c1
Sequence:CCGGCAGTATTGCTCAGGGATTAAACTCGAGTTTAATCCCTGAGCAATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024727.2-1522s21c1
Sequence:CCGGAGCTAATCGAGCTGGATATTACTCGAGTAATATCCAGCTCGATTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024727.1-1632s1c1
Sequence:CCGGCCTACTAAGCTACAAACCATTCTCGAGAATGGTTTGTAGCTTAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-521s1c1
Sequence:CCGGCTGATCCTTCAGAAGTTCCAACTCGAGTTGGAACTTCTGAAGGATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-875s1c1
Sequence:CCGGGTCATGCTAAAGCATCTACAACTCGAGTTGTAGATGCTTTAGCATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024727
LRRC31 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 31
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024727.1-1986s1c1
Sequence:CCGGGCTTTCCTCTTGCCCAGAAATCTCGAGATTTCTGGGCAAGAGGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-380s1c1
Sequence:CCGGGCTGTCAACAAGTGTCTAGATCTCGAGATCTAGACACTTGTTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-1052s1c1
Sequence:CCGGCCAGCATTGAAGTCATTAGTTCTCGAGAACTAATGACTTCAATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-172s1c1
Sequence:CCGGCCAGACTTCAACTGTCAACAACTCGAGTTGTTGACAGTTGAAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-305s1c1
Sequence:CCGGCCTCTCAGTTCAGAAATGGAACTCGAGTTCCATTTCTGAACTGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024727.2-809s21c1
Sequence:CCGGCAGTATTGCTCAGGGATTAAACTCGAGTTTAATCCCTGAGCAATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024727.2-1522s21c1
Sequence:CCGGAGCTAATCGAGCTGGATATTACTCGAGTAATATCCAGCTCGATTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024727.1-1632s1c1
Sequence:CCGGCCTACTAAGCTACAAACCATTCTCGAGAATGGTTTGTAGCTTAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-521s1c1
Sequence:CCGGCTGATCCTTCAGAAGTTCCAACTCGAGTTGGAACTTCTGAAGGATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024727.1-875s1c1
Sequence:CCGGGTCATGCTAAAGCATCTACAACTCGAGTTGTAGATGCTTTAGCATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)