EMAIL THIS PAGE TO A FRIEND

LRRC32

leucine rich repeat containing 32

98 Gene Product Result for
Synonyms: D11S833E GARP
UniProtKB ID: Q14392, Q86V06
Gene ID:
Human(2615) Summary: This gene encodes a type I membrane protein which contains 20 leucine-rich repeats. Alterations in the chromosomal region 11q13-11q14 are involved in several pathologies. [provided by RefSeq, Jul 2008]
Mouse(434215) leucine rich repeat containing 32
Rat(293135) leucine rich repeat containing 32
chicken(428121) leucine rich repeat containing 32
dog(485180) leucine rich repeat containing 32
cow(615467) leucine rich repeat containing 32
domestic cat(101089642) leucine rich repeat containing 32
sheep(101112256) leucine rich repeat containing 32
naked mole-rat(101724751) leucine rich repeat containing 32
domestic guinea pig(100717090) leucine rich repeat containing 32
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005512 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001113379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001113379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001113379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040281 MISSION® esiRNA esiRNA human LRRC32 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005512 Rosetta Predictions human pricing
XM_001065297 Rosetta Predictions rat pricing
XM_218947 Rosetta Predictions rat pricing
NM_001113379 Rosetta Predictions mouse pricing
XM_485967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127658 predicted 824
2 SASI_Hs01_00127659 predicted 1056
3 SASI_Hs01_00127660 predicted 1045
4 SASI_Hs01_00127661 predicted 1179
5 SASI_Hs01_00127662 predicted 707
6 SASI_Hs01_00127663 predicted 1656
7 SASI_Hs01_00127664 predicted 399
8 SASI_Hs01_00127665 predicted 323
9 SASI_Hs01_00127666 predicted 843
10 SASI_Hs02_00339726 predicted 552
11 SASI_Hs01_00127667 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313625 predicted 493
2 SASI_Rn02_00313626 predicted 465
3 SASI_Rn02_00313627 predicted 1373
4 SASI_Rn02_00313628 predicted 477
5 SASI_Rn02_00313629 predicted 1808
6 SASI_Rn02_00313630 predicted 1881
7 SASI_Rn02_00313631 predicted 249
8 SASI_Rn02_00313632 predicted 1286
9 SASI_Rn02_00313633 predicted 1360
10 SASI_Rn02_00313634 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378207 predicted 485
2 SASI_Rn02_00378208 predicted 468
3 SASI_Rn02_00378209 predicted 478
4 SASI_Rn02_00378210 predicted 1807
5 SASI_Rn02_00378211 predicted 1875
6 SASI_Rn02_00378212 predicted 247
7 SASI_Rn02_00378213 predicted 1848
8 SASI_Rn02_00378214 predicted 1899
9 SASI_Rn02_00378215 predicted 406
10 SASI_Rn02_00378216 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307588 predicted 1107
2 SASI_Mm02_00307589 predicted 1128
3 SASI_Mm02_00307590 predicted 1966
4 SASI_Mm02_00307591 predicted 798
5 SASI_Mm02_00307592 predicted 1421
6 SASI_Mm02_00307593 predicted 962
7 SASI_Mm02_00307594 predicted 968
8 SASI_Mm02_00307595 predicted 1188
9 SASI_Mm02_00307596 predicted 1191
10 SASI_Mm02_00307597 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284260 predicted 222
2 SASI_Mm01_00284261 predicted 306
3 SASI_Mm01_00284262 predicted 240
4 SASI_Mm01_00284263 predicted 238
5 SASI_Mm01_00284264 predicted 549
6 SASI_Mm01_00284265 predicted 396
7 SASI_Mm01_00284266 predicted 605
8 SASI_Mm01_00284267 predicted 710
9 SASI_Mm01_00284268 predicted 531
10 SASI_Mm01_00284269 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005512
LRRC32 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 32
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005512.2-2326s21c1
Sequence:CCGGGAACTCTGGTCTCCAAATTACCTCGAGGTAATTTGGAGACCAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005512.2-2632s21c1
Sequence:CCGGTTAGGGCCTGAGGTGTGAAAGCTCGAGCTTTCACACCTCAGGCCCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005512.2-2489s21c1
Sequence:CCGGATCTTCACTGAGCATGTATTTCTCGAGAAATACATGCTCAGTGAAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005512.2-393s21c1
Sequence:CCGGCACTGAGACCCTTGATCTATCCTCGAGGATAGATCAAGGGTCTCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005512.1-2615s1c1
Sequence:CCGGGCAGACTGTTTGTCACGTCTTCTCGAGAAGACGTGACAAACAGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-2053s1c1
Sequence:CCGGGCAGAAGTTTAACCAACAGTACTCGAGTACTGTTGGTTAAACTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-898s1c1
Sequence:CCGGCTACCTGAACTTGTCCAACAACTCGAGTTGTTGGACAAGTTCAGGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-1048s1c1
Sequence:CCGGGAATCTGGATTTGAGCTACAACTCGAGTTGTAGCTCAAATCCAGATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-154s1c1
Sequence:CCGGCCAAGACAAAGTGCCCTGTAACTCGAGTTACAGGGCACTTTGTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005512
LRRC32 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 32
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005512.2-2326s21c1
Sequence:CCGGGAACTCTGGTCTCCAAATTACCTCGAGGTAATTTGGAGACCAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005512.2-2632s21c1
Sequence:CCGGTTAGGGCCTGAGGTGTGAAAGCTCGAGCTTTCACACCTCAGGCCCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005512.2-2489s21c1
Sequence:CCGGATCTTCACTGAGCATGTATTTCTCGAGAAATACATGCTCAGTGAAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005512.2-393s21c1
Sequence:CCGGCACTGAGACCCTTGATCTATCCTCGAGGATAGATCAAGGGTCTCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005512.1-2615s1c1
Sequence:CCGGGCAGACTGTTTGTCACGTCTTCTCGAGAAGACGTGACAAACAGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-2053s1c1
Sequence:CCGGGCAGAAGTTTAACCAACAGTACTCGAGTACTGTTGGTTAAACTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-898s1c1
Sequence:CCGGCTACCTGAACTTGTCCAACAACTCGAGTTGTTGGACAAGTTCAGGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-1048s1c1
Sequence:CCGGGAATCTGGATTTGAGCTACAACTCGAGTTGTAGCTCAAATCCAGATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-154s1c1
Sequence:CCGGCCAAGACAAAGTGCCCTGTAACTCGAGTTACAGGGCACTTTGTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005512
LRRC32 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 32
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005512.2-2326s21c1
Sequence:CCGGGAACTCTGGTCTCCAAATTACCTCGAGGTAATTTGGAGACCAGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426078    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005512.2-2632s21c1
Sequence:CCGGTTAGGGCCTGAGGTGTGAAAGCTCGAGCTTTCACACCTCAGGCCCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005512.2-2489s21c1
Sequence:CCGGATCTTCACTGAGCATGTATTTCTCGAGAAATACATGCTCAGTGAAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005512.2-393s21c1
Sequence:CCGGCACTGAGACCCTTGATCTATCCTCGAGGATAGATCAAGGGTCTCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005512.1-2615s1c1
Sequence:CCGGGCAGACTGTTTGTCACGTCTTCTCGAGAAGACGTGACAAACAGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-2053s1c1
Sequence:CCGGGCAGAAGTTTAACCAACAGTACTCGAGTACTGTTGGTTAAACTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-898s1c1
Sequence:CCGGCTACCTGAACTTGTCCAACAACTCGAGTTGTTGGACAAGTTCAGGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-1048s1c1
Sequence:CCGGGAATCTGGATTTGAGCTACAACTCGAGTTGTAGCTCAAATCCAGATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005512.1-154s1c1
Sequence:CCGGCCAAGACAAAGTGCCCTGTAACTCGAGTTACAGGGCACTTTGTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001113379
LRRC32 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 32
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-517s21c1
Sequence:CCGGATGCCAGCGGTGGAGCAATTACTCGAGTAATTGCTCCACCGCTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113379.1-3491s21c1
Sequence:CCGGGTCAGCCAGAGCTTCCGTAATCTCGAGATTACGGAAGCTCTGGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-1542s21c1
Sequence:CCGGTCTCCGTCTCAAGCGCCTTAACTCGAGTTAAGGCGCTTGAGACGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-1780s21c1
Sequence:CCGGGATGCTACTCAGGACCTAATCCTCGAGGATTAGGTCCTGAGTAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-224s21c1
Sequence:CCGGCGCTTCGTCACCTGGATTTAACTCGAGTTAAATCCAGGTGACGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001113379
LRRC32 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 32
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-517s21c1
Sequence:CCGGATGCCAGCGGTGGAGCAATTACTCGAGTAATTGCTCCACCGCTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113379.1-3491s21c1
Sequence:CCGGGTCAGCCAGAGCTTCCGTAATCTCGAGATTACGGAAGCTCTGGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-1542s21c1
Sequence:CCGGTCTCCGTCTCAAGCGCCTTAACTCGAGTTAAGGCGCTTGAGACGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-1780s21c1
Sequence:CCGGGATGCTACTCAGGACCTAATCCTCGAGGATTAGGTCCTGAGTAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-224s21c1
Sequence:CCGGCGCTTCGTCACCTGGATTTAACTCGAGTTAAATCCAGGTGACGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001113379
LRRC32 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 32
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-517s21c1
Sequence:CCGGATGCCAGCGGTGGAGCAATTACTCGAGTAATTGCTCCACCGCTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113379.1-3491s21c1
Sequence:CCGGGTCAGCCAGAGCTTCCGTAATCTCGAGATTACGGAAGCTCTGGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-1542s21c1
Sequence:CCGGTCTCCGTCTCAAGCGCCTTAACTCGAGTTAAGGCGCTTGAGACGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-1780s21c1
Sequence:CCGGGATGCTACTCAGGACCTAATCCTCGAGGATTAGGTCCTGAGTAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113379.1-224s21c1
Sequence:CCGGCGCTTCGTCACCTGGATTTAACTCGAGTTAAATCCAGGTGACGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)