EMAIL THIS PAGE TO A FRIEND

LRRC34

leucine rich repeat containing 34

89 Gene Product Result for
UniProtKB ID: Q8IZ02, B4DEJ7, E9PBH2, G5E9T7
Gene ID:
Mouse(71827) leucine rich repeat containing 34
Rat(499589) leucine rich repeat containing 34
Zebrafish(556175) leucine rich repeat containing 34
cow(512714) leucine rich repeat containing 34
Horse(100063326) leucine rich repeat containing 34
domestic cat(101097584) leucine rich repeat containing 34
dog(488151) leucine rich repeat containing 34
chicken(424996) leucine rich repeat containing 34
sheep(101114161) leucine rich repeat containing 34
naked mole-rat(101726293) leucine rich repeat containing 34
domestic guinea pig(100728387) leucine rich repeat containing 34
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153353 Rosetta Predictions human pricing
NM_001044696 Rosetta Predictions rat pricing
NM_027941 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115385 predicted 897
2 SASI_Hs01_00115386 predicted 368
3 SASI_Hs02_00367213 predicted 932
4 SASI_Hs01_00115387 predicted 976
5 SASI_Hs01_00115388 predicted 360
6 SASI_Hs01_00115389 predicted 907
7 SASI_Hs01_00115391 predicted 574
8 SASI_Hs01_00115392 predicted 732
9 SASI_Hs01_00115394 predicted 958
10 SASI_Hs02_00367214 predicted 983
11 SASI_Hs01_00115390 predicted 274
12 SASI_Hs01_00115393 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205724 predicted 323
2 SASI_Rn02_00205725 predicted 1235
3 SASI_Rn02_00205726 predicted 1255
4 SASI_Rn02_00205727 predicted 566
5 SASI_Rn02_00205728 predicted 1081
6 SASI_Rn02_00205729 predicted 662
7 SASI_Rn02_00205730 predicted 962
8 SASI_Rn02_00205731 predicted 997
9 SASI_Rn02_00205732 predicted 1213
10 SASI_Rn02_00205733 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332933 predicted 1327
2 SASI_Mm02_00332934 predicted 281
3 SASI_Mm02_00332935 predicted 1111
4 SASI_Mm02_00332936 predicted 1034
5 SASI_Mm02_00332937 predicted 1074
6 SASI_Mm02_00332938 predicted 476
7 SASI_Mm02_00332939 predicted 855
8 SASI_Mm02_00332940 predicted 665
9 SASI_Mm02_00332941 predicted 978
10 SASI_Mm02_00332942 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153353
VALIDATED
LRRC34 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 34
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153353.4-748s21c1
Sequence:CCGGGATTGCTAAAGTGCTACATAACTCGAGTTATGTAGCACTTTAGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153353.2-1225s1c1
Sequence:CCGGCCACTCATCTAATGCAGGTTTCTCGAGAAACCTGCATTAGATGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153353.2-512s1c1
Sequence:CCGGCGGACTCTGAAATACCTAAGACTCGAGTCTTAGGTATTTCAGAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153353.2-1212s1c1
Sequence:CCGGGAGAATCTTATGACCACTCATCTCGAGATGAGTGGTCATAAGATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153353.2-287s1c1
Sequence:CCGGGTAGAAAGAGTTACAGGTGAACTCGAGTTCACCTGTAACTCTTTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153353.2-896s1c1
Sequence:CCGGGCAAACTATCTCAGTGAAACTCTCGAGAGTTTCACTGAGATAGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153353.4-1396s21c1
Sequence:CCGGTGTGGTAGATGGACGTGTATACTCGAGTATACACGTCCATCTACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153353.2-949s1c1
Sequence:CCGGGTCAGTAGTCAGCAACAACATCTCGAGATGTTGTTGCTGACTACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153353.4-1063s21c1
Sequence:CCGGTCATGATGGAATGGTGTATTTCTCGAGAAATACACCATTCCATCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153353
VALIDATED
LRRC34 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 34
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153353.4-748s21c1
Sequence:CCGGGATTGCTAAAGTGCTACATAACTCGAGTTATGTAGCACTTTAGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153353.2-1225s1c1
Sequence:CCGGCCACTCATCTAATGCAGGTTTCTCGAGAAACCTGCATTAGATGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153353.2-512s1c1
Sequence:CCGGCGGACTCTGAAATACCTAAGACTCGAGTCTTAGGTATTTCAGAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153353.2-1212s1c1
Sequence:CCGGGAGAATCTTATGACCACTCATCTCGAGATGAGTGGTCATAAGATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153353.2-287s1c1
Sequence:CCGGGTAGAAAGAGTTACAGGTGAACTCGAGTTCACCTGTAACTCTTTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153353.2-896s1c1
Sequence:CCGGGCAAACTATCTCAGTGAAACTCTCGAGAGTTTCACTGAGATAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153353.4-1396s21c1
Sequence:CCGGTGTGGTAGATGGACGTGTATACTCGAGTATACACGTCCATCTACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153353.2-949s1c1
Sequence:CCGGGTCAGTAGTCAGCAACAACATCTCGAGATGTTGTTGCTGACTACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153353.4-1063s21c1
Sequence:CCGGTCATGATGGAATGGTGTATTTCTCGAGAAATACACCATTCCATCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153353
VALIDATED
LRRC34 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 34
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153353.4-748s21c1
Sequence:CCGGGATTGCTAAAGTGCTACATAACTCGAGTTATGTAGCACTTTAGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153353.2-1225s1c1
Sequence:CCGGCCACTCATCTAATGCAGGTTTCTCGAGAAACCTGCATTAGATGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153353.2-512s1c1
Sequence:CCGGCGGACTCTGAAATACCTAAGACTCGAGTCTTAGGTATTTCAGAGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153353.2-1212s1c1
Sequence:CCGGGAGAATCTTATGACCACTCATCTCGAGATGAGTGGTCATAAGATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153353.2-287s1c1
Sequence:CCGGGTAGAAAGAGTTACAGGTGAACTCGAGTTCACCTGTAACTCTTTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153353.2-896s1c1
Sequence:CCGGGCAAACTATCTCAGTGAAACTCTCGAGAGTTTCACTGAGATAGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153353.4-1396s21c1
Sequence:CCGGTGTGGTAGATGGACGTGTATACTCGAGTATACACGTCCATCTACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_153353.2-949s1c1
Sequence:CCGGGTCAGTAGTCAGCAACAACATCTCGAGATGTTGTTGCTGACTACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153353.4-1063s21c1
Sequence:CCGGTCATGATGGAATGGTGTATTTCTCGAGAAATACACCATTCCATCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027941
LRRC34 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 34
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-1322s21c1
Sequence:CCGGTATTACTGGGCACCGACTTATCTCGAGATAAGTCGGTGCCCAGTAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-1192s21c1
Sequence:CCGGGGATACCTGTGTGGCATATTCCTCGAGGAATATGCCACACAGGTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-1295s21c1
Sequence:CCGGGAAGTCTCCAACGGCCTTAAACTCGAGTTTAAGGCCGTTGGAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-310s21c1
Sequence:CCGGTCGCTTAGACTCCGGACAAAGCTCGAGCTTTGTCCGGAGTCTAAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027941.1-1778s21c1
Sequence:CCGGCATTACAGACAGGTGCTAATACTCGAGTATTAGCACCTGTCTGTAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027941
LRRC34 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 34
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-1322s21c1
Sequence:CCGGTATTACTGGGCACCGACTTATCTCGAGATAAGTCGGTGCCCAGTAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-1192s21c1
Sequence:CCGGGGATACCTGTGTGGCATATTCCTCGAGGAATATGCCACACAGGTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-1295s21c1
Sequence:CCGGGAAGTCTCCAACGGCCTTAAACTCGAGTTTAAGGCCGTTGGAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-310s21c1
Sequence:CCGGTCGCTTAGACTCCGGACAAAGCTCGAGCTTTGTCCGGAGTCTAAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027941.1-1778s21c1
Sequence:CCGGCATTACAGACAGGTGCTAATACTCGAGTATTAGCACCTGTCTGTAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027941
LRRC34 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 34
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-1322s21c1
Sequence:CCGGTATTACTGGGCACCGACTTATCTCGAGATAAGTCGGTGCCCAGTAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-1192s21c1
Sequence:CCGGGGATACCTGTGTGGCATATTCCTCGAGGAATATGCCACACAGGTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-1295s21c1
Sequence:CCGGGAAGTCTCCAACGGCCTTAAACTCGAGTTTAAGGCCGTTGGAGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027941.1-310s21c1
Sequence:CCGGTCGCTTAGACTCCGGACAAAGCTCGAGCTTTGTCCGGAGTCTAAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027941.1-1778s21c1
Sequence:CCGGCATTACAGACAGGTGCTAATACTCGAGTATTAGCACCTGTCTGTAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)