EMAIL THIS PAGE TO A FRIEND

LRRC36

leucine rich repeat containing 36

93 Gene Product Result for
Synonyms: RORBP70 XLHSRF2
UniProtKB ID: Q1X8D7, A4FTV6, A6NDE9, A8K8E6, Q7Z5K5
Gene ID:
Mouse(270091) leucine rich repeat containing 36
Rat(361394) leucine rich repeat containing 36
domestic guinea pig(100731302) leucine rich repeat containing 36
naked mole-rat(101713781) leucine rich repeat containing 36
Domestic Rabbit(100345840) leucine rich repeat containing 36
sheep(101113262) leucine rich repeat containing 36
cow(512403) leucine rich repeat containing 36
Horse(100065977) leucine rich repeat containing 36
domestic cat(101089312) leucine rich repeat containing 36
dog(479688) leucine rich repeat containing 36
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018296 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018296 Rosetta Predictions human pricing
NM_001004088 Rosetta Predictions rat pricing
XM_001067577 Rosetta Predictions rat pricing
XM_001072518 Rosetta Predictions rat pricing
NM_001033371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184674 predicted 847
2 SASI_Hs01_00184675 predicted 1095
3 SASI_Hs01_00184676 predicted 201
4 SASI_Hs01_00184677 predicted 1138
5 SASI_Hs01_00184678 predicted 2056
6 SASI_Hs01_00184679 predicted 1070
7 SASI_Hs01_00184680 predicted 921
8 SASI_Hs01_00184681 predicted 1418
9 SASI_Hs02_00351696 predicted 1507
10 SASI_Hs02_00351697 predicted 992
11 SASI_Hs01_00184672 predicted 323
12 SASI_Hs01_00184673 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198128 predicted 988
2 SASI_Rn02_00198129 predicted 1014
3 SASI_Rn02_00198130 predicted 313
4 SASI_Rn02_00198131 predicted 1084
5 SASI_Rn02_00198132 predicted 1339
6 SASI_Rn02_00198133 predicted 887
7 SASI_Rn02_00198134 predicted 1528
8 SASI_Rn02_00198135 predicted 837
9 SASI_Rn02_00198136 predicted 745
10 SASI_Rn02_00198137 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321444 predicted 637
2 SASI_Rn02_00321445 predicted 637
3 SASI_Rn02_00321446 predicted 888
4 SASI_Rn02_00321447 predicted 834
5 SASI_Rn02_00321448 predicted 742
6 SASI_Rn02_00321449 predicted 627
7 SASI_Rn02_00321450 predicted 783
8 SASI_Rn02_00321451 predicted 951
9 SASI_Rn02_00321452 predicted 918
10 SASI_Rn02_00321453 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339504 predicted 985
2 SASI_Rn02_00339505 predicted 1009
3 SASI_Rn02_00339506 predicted 314
4 SASI_Rn02_00339507 predicted 1081
5 SASI_Rn02_00339508 predicted 1338
6 SASI_Rn02_00339509 predicted 888
7 SASI_Rn02_00339510 predicted 1537
8 SASI_Rn02_00339511 predicted 838
9 SASI_Rn02_00339512 predicted 745
10 SASI_Rn02_00339513 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184867 predicted 307
2 SASI_Mm02_00288671 predicted 1479
3 SASI_Mm01_00184868 predicted 1004
4 SASI_Mm01_00184869 predicted 823
5 SASI_Mm01_00184870 predicted 952
6 SASI_Mm01_00184871 predicted 1785
7 SASI_Mm02_00288672 predicted 747
8 SASI_Mm01_00184873 predicted 883
9 SASI_Mm01_00184874 predicted 489
10 SASI_Mm01_00184875 predicted 1008
11 SASI_Mm01_00184866 predicted 694
12 SASI_Mm01_00184872 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018296
LRRC36 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 36
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-1428s21c1
Sequence:CCGGCATCGAAGAGAGGATTCAAATCTCGAGATTTGAATCCTCTCTTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-171s21c1
Sequence:CCGGATCTCCGATCCTTAGATTTATCTCGAGATAAATCTAAGGATCGGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-1260s21c1
Sequence:CCGGTCAATGTAGAGCAACAATTATCTCGAGATAATTGTTGCTCTACATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-1097s21c1
Sequence:CCGGTATAGCATAAAGCCTTCAAATCTCGAGATTTGAAGGCTTTATGCTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-104s21c1
Sequence:CCCGCTTTCATTGCAGGGATCTTATCTCGAGATAAGATCCCTGCAATGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-972s21c1
Sequence:CCGGAGATCCATCCCTATCAGTTACCTCGAGGTAACTGATAGGGATGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-2103s1c1
Sequence:CCGGGCAGCTGAATAAGGAGCCAAACTCGAGTTTGGCTCCTTATTCAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-1206s1c1
Sequence:CCGGGAAGCTTAGTTCAGATCTGTACTCGAGTACAGATCTGAACTAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-2241s1c1
Sequence:CCGGGTATCTAATACAGAGCGTCTTCTCGAGAAGACGCTCTGTATTAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018296.2-985s1c1
Sequence:CCGGCCCTATCAGTTACCTTCAGATCTCGAGATCTGAAGGTAACTGATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-1148s1c1
Sequence:CCGGCCTGTGGAGACTTATTAACTTCTCGAGAAGTTAATAAGTCTCCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018296
LRRC36 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 36
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-1428s21c1
Sequence:CCGGCATCGAAGAGAGGATTCAAATCTCGAGATTTGAATCCTCTCTTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-171s21c1
Sequence:CCGGATCTCCGATCCTTAGATTTATCTCGAGATAAATCTAAGGATCGGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-1260s21c1
Sequence:CCGGTCAATGTAGAGCAACAATTATCTCGAGATAATTGTTGCTCTACATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-1097s21c1
Sequence:CCGGTATAGCATAAAGCCTTCAAATCTCGAGATTTGAAGGCTTTATGCTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-104s21c1
Sequence:CCCGCTTTCATTGCAGGGATCTTATCTCGAGATAAGATCCCTGCAATGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-972s21c1
Sequence:CCGGAGATCCATCCCTATCAGTTACCTCGAGGTAACTGATAGGGATGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-2103s1c1
Sequence:CCGGGCAGCTGAATAAGGAGCCAAACTCGAGTTTGGCTCCTTATTCAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-1206s1c1
Sequence:CCGGGAAGCTTAGTTCAGATCTGTACTCGAGTACAGATCTGAACTAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-2241s1c1
Sequence:CCGGGTATCTAATACAGAGCGTCTTCTCGAGAAGACGCTCTGTATTAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018296.2-985s1c1
Sequence:CCGGCCCTATCAGTTACCTTCAGATCTCGAGATCTGAAGGTAACTGATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-1148s1c1
Sequence:CCGGCCTGTGGAGACTTATTAACTTCTCGAGAAGTTAATAAGTCTCCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018296
LRRC36 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 36
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-1428s21c1
Sequence:CCGGCATCGAAGAGAGGATTCAAATCTCGAGATTTGAATCCTCTCTTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-171s21c1
Sequence:CCGGATCTCCGATCCTTAGATTTATCTCGAGATAAATCTAAGGATCGGAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-1260s21c1
Sequence:CCGGTCAATGTAGAGCAACAATTATCTCGAGATAATTGTTGCTCTACATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-1097s21c1
Sequence:CCGGTATAGCATAAAGCCTTCAAATCTCGAGATTTGAAGGCTTTATGCTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-104s21c1
Sequence:CCCGCTTTCATTGCAGGGATCTTATCTCGAGATAAGATCCCTGCAATGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018296.5-972s21c1
Sequence:CCGGAGATCCATCCCTATCAGTTACCTCGAGGTAACTGATAGGGATGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-2103s1c1
Sequence:CCGGGCAGCTGAATAAGGAGCCAAACTCGAGTTTGGCTCCTTATTCAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-1206s1c1
Sequence:CCGGGAAGCTTAGTTCAGATCTGTACTCGAGTACAGATCTGAACTAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-2241s1c1
Sequence:CCGGGTATCTAATACAGAGCGTCTTCTCGAGAAGACGCTCTGTATTAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018296.2-985s1c1
Sequence:CCGGCCCTATCAGTTACCTTCAGATCTCGAGATCTGAAGGTAACTGATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018296.2-1148s1c1
Sequence:CCGGCCTGTGGAGACTTATTAACTTCTCGAGAAGTTAATAAGTCTCCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033371
LRRC36 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 36
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1409s21c1
Sequence:CCGGGCGCTCGAAGCTTGACGATAACTCGAGTTATCGTCAAGCTTCGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1737s21c1
Sequence:CCGGAGGTCCCTGGTGGTAACTAATCTCGAGATTAGTTACCACCAGGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1069s21c1
Sequence:CCGGTTCCGACTAAGAGGTCATTAACTCGAGTTAATGACCTCTTAGTCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-764s21c1
Sequence:CCGGCTACCGAGAACATAGCATAAACTCGAGTTTATGCTATGTTCTCGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1899s21c1
Sequence:CCGGGACACGGGTCAGTACCTAATACTCGAGTATTAGGTACTGACCCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033371
LRRC36 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 36
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1409s21c1
Sequence:CCGGGCGCTCGAAGCTTGACGATAACTCGAGTTATCGTCAAGCTTCGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1737s21c1
Sequence:CCGGAGGTCCCTGGTGGTAACTAATCTCGAGATTAGTTACCACCAGGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1069s21c1
Sequence:CCGGTTCCGACTAAGAGGTCATTAACTCGAGTTAATGACCTCTTAGTCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-764s21c1
Sequence:CCGGCTACCGAGAACATAGCATAAACTCGAGTTTATGCTATGTTCTCGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1899s21c1
Sequence:CCGGGACACGGGTCAGTACCTAATACTCGAGTATTAGGTACTGACCCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033371
LRRC36 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 36
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1409s21c1
Sequence:CCGGGCGCTCGAAGCTTGACGATAACTCGAGTTATCGTCAAGCTTCGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1737s21c1
Sequence:CCGGAGGTCCCTGGTGGTAACTAATCTCGAGATTAGTTACCACCAGGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1069s21c1
Sequence:CCGGTTCCGACTAAGAGGTCATTAACTCGAGTTAATGACCTCTTAGTCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-764s21c1
Sequence:CCGGCTACCGAGAACATAGCATAAACTCGAGTTTATGCTATGTTCTCGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033371.2-1899s21c1
Sequence:CCGGGACACGGGTCAGTACCTAATACTCGAGTATTAGGTACTGACCCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)