EMAIL THIS PAGE TO A FRIEND

LRRC37A11P

leucine rich repeat containing 37, member A11, pseudogene

159 Gene Product Result for
Species: Human LRRC37A11P(342666)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198502 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017719 Rosetta Predictions human pricing
XR_040619 Rosetta Predictions human pricing
XR_040620 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494172 predicted 1275
2 SASI_Hs02_00494173 predicted 1518
3 SASI_Hs02_00494174 predicted 1301
4 SASI_Hs02_00494175 predicted 2169
5 SASI_Hs02_00494176 predicted 1242
6 SASI_Hs02_00494177 predicted 1247
7 SASI_Hs02_00494178 predicted 1303
8 SASI_Hs02_00494179 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520454 predicted 1256
2 SASI_Hs02_00520455 predicted 1493
3 SASI_Hs02_00520456 predicted 1273
4 SASI_Hs02_00520457 predicted 2143
5 SASI_Hs02_00520458 predicted 1217
6 SASI_Hs02_00520459 predicted 1212
7 SASI_Hs02_00520460 predicted 1274
8 SASI_Hs02_00520461 predicted 185
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520462 predicted 1218
2 SASI_Hs02_00520463 predicted 1454
3 SASI_Hs02_00520464 predicted 1240
4 SASI_Hs02_00520465 predicted 2101
5 SASI_Hs02_00520466 predicted 1176
6 SASI_Hs02_00520467 predicted 1183
7 SASI_Hs02_00520468 predicted 1237
8 SASI_Hs02_00520469 predicted 146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198502
LRRC37A11P MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 37, member A11, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-1617s1c1
Sequence:CCGGCCTGAAGAAGATTCCTCCCAACTCGAGTTGGGAGGAATCTTCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-1744s1c1
Sequence:CCGGGAATCCACTATGGAGGTTGAACTCGAGTTCAACCTCCATAGTGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-2197s1c1
Sequence:CCGGCCCACTACAGAGATTGGATATCTCGAGATATCCAATCTCTGTAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-1726s1c1
Sequence:CCGGGAACTTACCTTAACTCCAGAACTCGAGTTCTGGAGTTAAGGTAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198502.1-2564s1c1
Sequence:CCGGGTGAAGATGTATGGAAAGCATCTCGAGATGCTTTCCATACATCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198502
LRRC37A11P MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 37, member A11, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-1617s1c1
Sequence:CCGGCCTGAAGAAGATTCCTCCCAACTCGAGTTGGGAGGAATCTTCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-1744s1c1
Sequence:CCGGGAATCCACTATGGAGGTTGAACTCGAGTTCAACCTCCATAGTGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-2197s1c1
Sequence:CCGGCCCACTACAGAGATTGGATATCTCGAGATATCCAATCTCTGTAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-1726s1c1
Sequence:CCGGGAACTTACCTTAACTCCAGAACTCGAGTTCTGGAGTTAAGGTAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198502.1-2564s1c1
Sequence:CCGGGTGAAGATGTATGGAAAGCATCTCGAGATGCTTTCCATACATCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198502
LRRC37A11P MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 37, member A11, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-1617s1c1
Sequence:CCGGCCTGAAGAAGATTCCTCCCAACTCGAGTTGGGAGGAATCTTCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-1744s1c1
Sequence:CCGGGAATCCACTATGGAGGTTGAACTCGAGTTCAACCTCCATAGTGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-2197s1c1
Sequence:CCGGCCCACTACAGAGATTGGATATCTCGAGATATCCAATCTCTGTAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198502.1-1726s1c1
Sequence:CCGGGAACTTACCTTAACTCCAGAACTCGAGTTCTGGAGTTAAGGTAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198502.1-2564s1c1
Sequence:CCGGGTGAAGATGTATGGAAAGCATCTCGAGATGCTTTCCATACATCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)