EMAIL THIS PAGE TO A FRIEND

LRRC37A2

leucine rich repeat containing 37, member A2

23 Gene Product Result for
UniProtKB ID: A6NM11
Gene ID:
dog(607401) leucine rich repeat containing 37, member A2
naked mole-rat(101729390) leucine rich repeat containing 37, member A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006607 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118101 MISSION® esiRNA esiRNA human LRRC37A4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006607 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305076 predicted 543
2 SASI_Hs02_00305077 predicted 826
3 SASI_Hs02_00305078 predicted 829
4 SASI_Hs01_00163476 predicted 3865
5 SASI_Hs02_00305079 predicted 870
6 SASI_Hs02_00305080 predicted 1043
7 SASI_Hs02_00305081 predicted 493
8 SASI_Hs02_00305082 predicted 803
9 SASI_Hs02_00305083 predicted 545
10 SASI_Hs01_00163478 predicted 3891
11 SASI_Hs01_00163475 predicted 1102
12 SASI_Hs01_00163477 predicted 1366
13 SASI_Hs01_00163479 predicted 2648
14 SASI_Hs01_00163480 predicted 3173
15 SASI_Hs01_00163481 predicted 1377
16 SASI_Hs01_00163482 predicted 3176
17 SASI_Hs01_00163483 predicted 1092
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006607
LRRC37A2 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 37, member A2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006607.1-1821s1c1
Sequence:CCGGGATGTGAAATCACTGTTACTACTCGAGTAGTAACAGTGATTTCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-494s21c1
Sequence:CCGGTTGGAATTACACGCCAATTATCTCGAGATAATTGGCGTGTAATTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-1443s21c1
Sequence:CCGGTCAATCTCCGGAACCTATTAACTCGAGTTAATAGGTTCCGGAGATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-858s21c1
Sequence:CCGGAGGTGAGGATCAAGCTTATTACTCGAGTAATAAGCTTGATCCTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-1197s21c1
Sequence:CCGGTCACCATCAAACTCATCATTTCTCGAGAAATGATGAGTTTGATGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-3822s21c1
Sequence:CCGGAGACTTAACCCACGCTATTTCCTCGAGGAAATAGCGTGGGTTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006607
LRRC37A2 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 37, member A2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006607.1-1821s1c1
Sequence:CCGGGATGTGAAATCACTGTTACTACTCGAGTAGTAACAGTGATTTCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-494s21c1
Sequence:CCGGTTGGAATTACACGCCAATTATCTCGAGATAATTGGCGTGTAATTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-1443s21c1
Sequence:CCGGTCAATCTCCGGAACCTATTAACTCGAGTTAATAGGTTCCGGAGATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-858s21c1
Sequence:CCGGAGGTGAGGATCAAGCTTATTACTCGAGTAATAAGCTTGATCCTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-1197s21c1
Sequence:CCGGTCACCATCAAACTCATCATTTCTCGAGAAATGATGAGTTTGATGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-3822s21c1
Sequence:CCGGAGACTTAACCCACGCTATTTCCTCGAGGAAATAGCGTGGGTTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006607
LRRC37A2 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 37, member A2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006607.1-1821s1c1
Sequence:CCGGGATGTGAAATCACTGTTACTACTCGAGTAGTAACAGTGATTTCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-494s21c1
Sequence:CCGGTTGGAATTACACGCCAATTATCTCGAGATAATTGGCGTGTAATTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-1443s21c1
Sequence:CCGGTCAATCTCCGGAACCTATTAACTCGAGTTAATAGGTTCCGGAGATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-858s21c1
Sequence:CCGGAGGTGAGGATCAAGCTTATTACTCGAGTAATAAGCTTGATCCTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-1197s21c1
Sequence:CCGGTCACCATCAAACTCATCATTTCTCGAGAAATGATGAGTTTGATGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006607.2-3822s21c1
Sequence:CCGGAGACTTAACCCACGCTATTTCCTCGAGGAAATAGCGTGGGTTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)