EMAIL THIS PAGE TO A FRIEND

LRRC37A3

leucine rich repeat containing 37, member A3

21 Gene Product Result for
Synonyms: LRRC37A
Species: Human LRRC37A3(374819), naked mole-rat Lrrc37a3(101718063)
UniProtKB ID: O60309, Q49A01, Q49A80, Q8NB33
Gene ID:
naked mole-rat(101718063) leucine rich repeat containing 37, member A3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199340 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199340 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161491 predicted 3912
2 SASI_Hs02_00372776 predicted 1070
3 SASI_Hs01_00161494 predicted 4404
4 SASI_Hs01_00161495 predicted 4407
5 SASI_Hs01_00161496 predicted 3862
6 SASI_Hs01_00161497 predicted 1356
7 SASI_Hs01_00161499 predicted 3872
8 SASI_Hs01_00161500 predicted 1355
9 SASI_Hs02_00372777 predicted 3866
10 SASI_Hs02_00372778 predicted 1395
11 SASI_Hs01_00161492 predicted 5378
12 SASI_Hs01_00161493 predicted 3900
13 SASI_Hs01_00161498 predicted 3041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199340
LRRC37A3 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 37, member A3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-5284s1c1
Sequence:CCGGGCGTTAATTGTGACTGGAATACTCGAGTATTCCAGTCACAATTAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-2155s1c1
Sequence:CCGGGCCACAGTTCAACCTTTGGATCTCGAGATCCAAAGGTTGAACTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-5163s1c1
Sequence:CCGGCCAATGGAAGACTGAGAACTACTCGAGTAGTTCTCAGTCTTCCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-1576s1c1
Sequence:CCGGCCTCCTATGGAGCATGAACTTCTCGAGAAGTTCATGCTCCATAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-2792s1c1
Sequence:CCGGCCATCATTCCAGAACCCACTACTCGAGTAGTGGGTTCTGGAATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-3038s1c1
Sequence:CCGGGCGGAGATGAGATGTTGTCATCTCGAGATGACAACATCTCATCTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199340
LRRC37A3 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 37, member A3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-5284s1c1
Sequence:CCGGGCGTTAATTGTGACTGGAATACTCGAGTATTCCAGTCACAATTAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-2155s1c1
Sequence:CCGGGCCACAGTTCAACCTTTGGATCTCGAGATCCAAAGGTTGAACTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-5163s1c1
Sequence:CCGGCCAATGGAAGACTGAGAACTACTCGAGTAGTTCTCAGTCTTCCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-1576s1c1
Sequence:CCGGCCTCCTATGGAGCATGAACTTCTCGAGAAGTTCATGCTCCATAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-2792s1c1
Sequence:CCGGCCATCATTCCAGAACCCACTACTCGAGTAGTGGGTTCTGGAATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-3038s1c1
Sequence:CCGGGCGGAGATGAGATGTTGTCATCTCGAGATGACAACATCTCATCTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199340
LRRC37A3 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 37, member A3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-5284s1c1
Sequence:CCGGGCGTTAATTGTGACTGGAATACTCGAGTATTCCAGTCACAATTAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-2155s1c1
Sequence:CCGGGCCACAGTTCAACCTTTGGATCTCGAGATCCAAAGGTTGAACTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-5163s1c1
Sequence:CCGGCCAATGGAAGACTGAGAACTACTCGAGTAGTTCTCAGTCTTCCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-1576s1c1
Sequence:CCGGCCTCCTATGGAGCATGAACTTCTCGAGAAGTTCATGCTCCATAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-2792s1c1
Sequence:CCGGCCATCATTCCAGAACCCACTACTCGAGTAGTGGGTTCTGGAATGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199340.2-3038s1c1
Sequence:CCGGGCGGAGATGAGATGTTGTCATCTCGAGATGACAACATCTCATCTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)