EMAIL THIS PAGE TO A FRIEND

LRRC37A6P

leucine rich repeat containing 37, member A6, pseudogene

19 Gene Product Result for
Species: Human LRRC37A6P(387646)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006604 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006604 Rosetta Predictions human pricing
NR_003525 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202367 predicted 897
2 SASI_Hs01_00202368 predicted 913
3 SASI_Hs01_00202369 predicted 841
4 SASI_Hs01_00202370 predicted 624
5 SASI_Hs01_00202371 predicted 432
6 SASI_Hs01_00202372 predicted 686
7 SASI_Hs01_00202373 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379417 predicted 5855
2 SASI_Hs02_00379418 predicted 4759
3 SASI_Hs02_00379419 predicted 2630
4 SASI_Hs02_00379420 predicted 1194
5 SASI_Hs02_00379421 predicted 5143
6 SASI_Hs02_00379422 predicted 4680
7 SASI_Hs02_00379423 predicted 6136
8 SASI_Hs02_00379424 predicted 1145
9 SASI_Hs02_00379425 predicted 4485
10 SASI_Hs02_00379426 predicted 4979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006604
LRRC37A6P MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 37, member A6, pseudogene
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000172904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006604.1-682s1c1
Sequence:CCGGGTAGCTCAATCTCCGGAACATCTCGAGATGTTCCGGAGATTGAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006604.1-694s1c1
Sequence:CCGGCCGGAACATTCAAACCTGACTCTCGAGAGTCAGGTTTGAATGTTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006604
LRRC37A6P MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 37, member A6, pseudogene
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000172904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006604.1-682s1c1
Sequence:CCGGGTAGCTCAATCTCCGGAACATCTCGAGATGTTCCGGAGATTGAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006604.1-694s1c1
Sequence:CCGGCCGGAACATTCAAACCTGACTCTCGAGAGTCAGGTTTGAATGTTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006604
LRRC37A6P MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 37, member A6, pseudogene
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000172904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006604.1-682s1c1
Sequence:CCGGGTAGCTCAATCTCCGGAACATCTCGAGATGTTCCGGAGATTGAGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006604.1-694s1c1
Sequence:CCGGCCGGAACATTCAAACCTGACTCTCGAGAGTCAGGTTTGAATGTTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)