EMAIL THIS PAGE TO A FRIEND

LRRC37A

leucine rich repeat containing 37A

56 Gene Product Result for
UniProtKB ID: A6NMS7, Q68DY2, Q8IWC7
Gene ID:
Mouse(237954) leucine rich repeat containing 37A
Rat(303556) leucine rich repeat containing 37A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014834 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014834 Rosetta Predictions human pricing
XM_001081536 Rosetta Predictions rat pricing
XM_220928 Rosetta Predictions rat pricing
XM_137868 Rosetta Predictions mouse pricing
XM_906537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123681 predicted 537
2 SASI_Hs01_00123683 predicted 827
3 SASI_Hs01_00123685 predicted 825
4 SASI_Hs01_00123686 predicted 3867
5 SASI_Hs01_00123688 predicted 861
6 SASI_Hs02_00346388 predicted 1043
7 SASI_Hs01_00123690 predicted 491
8 SASI_Hs02_00346389 predicted 805
9 SASI_Hs02_00346390 predicted 544
10 SASI_Hs02_00346391 predicted 3888
11 SASI_Hs01_00123682 predicted 4947
12 SASI_Hs01_00123684 predicted 2512
13 SASI_Hs01_00123687 predicted 4949
14 SASI_Hs01_00123689 predicted 2533
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372330 predicted 4791
2 SASI_Rn02_00372331 predicted 2056
3 SASI_Rn02_00372332 predicted 2950
4 SASI_Rn02_00372333 predicted 6031
5 SASI_Rn02_00372334 predicted 569
6 SASI_Rn02_00372335 predicted 2295
7 SASI_Rn02_00372336 predicted 6191
8 SASI_Rn02_00372337 predicted 5205
9 SASI_Rn02_00372338 predicted 1832
10 SASI_Rn02_00372339 predicted 5564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379684 predicted 8155
2 SASI_Rn02_00379685 predicted 8367
3 SASI_Rn02_00379686 predicted 8304
4 SASI_Rn02_00379687 predicted 8152
5 SASI_Rn02_00379688 predicted 8325
6 SASI_Rn02_00379689 predicted 8350
7 SASI_Rn02_00379690 predicted 8350
8 SASI_Rn02_00379691 predicted 8345
9 SASI_Rn02_00379692 predicted 8329
10 SASI_Rn02_00379693 predicted 8361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_137868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424788 predicted 9883
2 SASI_Mm02_00424789 predicted 9883
3 SASI_Mm02_00424790 predicted 9756
4 SASI_Mm02_00424791 predicted 9749
5 SASI_Mm02_00424792 predicted 9840
6 SASI_Mm02_00424793 predicted 9882
7 SASI_Mm02_00424794 predicted 9754
8 SASI_Mm02_00424795 predicted 9765
9 SASI_Mm02_00424796 predicted 9832
10 SASI_Mm02_00424797 predicted 9877
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432584 predicted 4033
2 SASI_Mm02_00432585 predicted 7741
3 SASI_Mm02_00432586 predicted 5075
4 SASI_Mm02_00432587 predicted 3071
5 SASI_Mm02_00432588 predicted 3113
6 SASI_Mm02_00432589 predicted 6434
7 SASI_Mm02_00432590 predicted 6582
8 SASI_Mm02_00432591 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014834
LRRC37A MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 37A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-4610s1c1
Sequence:CCGGCATCCAAGATAGAATGGGATACTCGAGTATCCCATTCTATCTTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1408s1c1
Sequence:CCGGGCTGGACCTTTAGCAGTTCAACTCGAGTTGAACTGCTAAAGGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-907s1c1
Sequence:CCGGGCAGATGTGGAGGTTACCATACTCGAGTATGGTAACCTCCACATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-442s1c1
Sequence:CCGGCCCAAGAAGCTGAAGAAAGATCTCGAGATCTTTCTTCAGCTTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1673s1c1
Sequence:CCGGCCATGACAGAGGTTGAACTTTCTCGAGAAAGTTCAACCTCTGTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-4825s1c1
Sequence:CCGGCGAAGGTCATTACAAGAAGATCTCGAGATCTTCTTGTAATGACCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-480s1c1
Sequence:CCGGCCTTGCTGAGATTATTGGAATCTCGAGATTCCAATAATCTCAGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-3819s1c1
Sequence:CCGGGAAAGACTTAACCCACGCTATCTCGAGATAGCGTGGGTTAAGTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1192s1c1
Sequence:CCGGCCAGGTCACCATCAAACTCATCTCGAGATGAGTTTGATGGTGACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1814s1c1
Sequence:CCGGCCAGCGTTACAGTTCAACTTTCTCGAGAAAGTTGAACTGTAACGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014834
LRRC37A MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 37A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-4610s1c1
Sequence:CCGGCATCCAAGATAGAATGGGATACTCGAGTATCCCATTCTATCTTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1408s1c1
Sequence:CCGGGCTGGACCTTTAGCAGTTCAACTCGAGTTGAACTGCTAAAGGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-907s1c1
Sequence:CCGGGCAGATGTGGAGGTTACCATACTCGAGTATGGTAACCTCCACATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-442s1c1
Sequence:CCGGCCCAAGAAGCTGAAGAAAGATCTCGAGATCTTTCTTCAGCTTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1673s1c1
Sequence:CCGGCCATGACAGAGGTTGAACTTTCTCGAGAAAGTTCAACCTCTGTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-4825s1c1
Sequence:CCGGCGAAGGTCATTACAAGAAGATCTCGAGATCTTCTTGTAATGACCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-480s1c1
Sequence:CCGGCCTTGCTGAGATTATTGGAATCTCGAGATTCCAATAATCTCAGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-3819s1c1
Sequence:CCGGGAAAGACTTAACCCACGCTATCTCGAGATAGCGTGGGTTAAGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1192s1c1
Sequence:CCGGCCAGGTCACCATCAAACTCATCTCGAGATGAGTTTGATGGTGACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1814s1c1
Sequence:CCGGCCAGCGTTACAGTTCAACTTTCTCGAGAAAGTTGAACTGTAACGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014834
LRRC37A MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 37A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-4610s1c1
Sequence:CCGGCATCCAAGATAGAATGGGATACTCGAGTATCCCATTCTATCTTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1408s1c1
Sequence:CCGGGCTGGACCTTTAGCAGTTCAACTCGAGTTGAACTGCTAAAGGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-907s1c1
Sequence:CCGGGCAGATGTGGAGGTTACCATACTCGAGTATGGTAACCTCCACATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-442s1c1
Sequence:CCGGCCCAAGAAGCTGAAGAAAGATCTCGAGATCTTTCTTCAGCTTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1673s1c1
Sequence:CCGGCCATGACAGAGGTTGAACTTTCTCGAGAAAGTTCAACCTCTGTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-4825s1c1
Sequence:CCGGCGAAGGTCATTACAAGAAGATCTCGAGATCTTCTTGTAATGACCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-480s1c1
Sequence:CCGGCCTTGCTGAGATTATTGGAATCTCGAGATTCCAATAATCTCAGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-3819s1c1
Sequence:CCGGGAAAGACTTAACCCACGCTATCTCGAGATAGCGTGGGTTAAGTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1192s1c1
Sequence:CCGGCCAGGTCACCATCAAACTCATCTCGAGATGAGTTTGATGGTGACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014834.2-1814s1c1
Sequence:CCGGCCAGCGTTACAGTTCAACTTTCTCGAGAAAGTTGAACTGTAACGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)