EMAIL THIS PAGE TO A FRIEND

LRRC37BP1

leucine rich repeat containing 37B pseudogene 1

153 Gene Product Result for
Synonyms: LRRC37B2
Species: Human LRRC37BP1(147172)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_290795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290795 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207323 Rosetta Predictions human pricing
NR_015341 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045239 predicted 686
2 SASI_Hs01_00045240 predicted 507
3 SASI_Hs01_00045241 predicted 482
4 SASI_Hs01_00045242 predicted 511
5 SASI_Hs01_00045243 predicted 556
6 SASI_Hs01_00045244 predicted 746
7 SASI_Hs01_00045245 predicted 535
8 SASI_Hs01_00045246 predicted 391
9 SASI_Hs01_00045247 predicted 680
10 SASI_Hs01_00045248 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381072 predicted 1530
2 SASI_Hs02_00381073 predicted 1335
3 SASI_Hs02_00381074 predicted 509
4 SASI_Hs02_00381075 predicted 776
5 SASI_Hs02_00381076 predicted 1504
6 SASI_Hs02_00381077 predicted 1544
7 SASI_Hs02_00381078 predicted 258
8 SASI_Hs02_00381079 predicted 1455
9 SASI_Hs02_00381080 predicted 1332
10 SASI_Hs02_00381081 predicted 1185
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290795
LRRC37BP1 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 37B pseudogene 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-938s1c1
Sequence:CCGGGCAGCGCACTAAGTTACATCTCTCGAGAGATGTAACTTAGTGCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-1447s1c1
Sequence:CCGGGCAATATCTGTGACTGTCATACTCGAGTATGACAGTCACAGATATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-1303s1c1
Sequence:CCGGGCATTGAATGTAGAATGGGATCTCGAGATCCCATTCTACATTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290795.4-1158s1c1
Sequence:CCGGCGAGGATGTGAGAAAGTTCATCTCGAGATGAACTTTCTCACATCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-637s1c1
Sequence:CCGGGCATGTCTAACAGCATACACTCTCGAGAGTGTATGCTGTTAGACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-1006s1c1
Sequence:CCGGCCGTTCACTGAACAGCTATTTCTCGAGAAATAGCTGTTCAGTGAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290795.4-1446s1c1
Sequence:CCGGCGCAATATCTGTGACTGTCATCTCGAGATGACAGTCACAGATATTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290795
LRRC37BP1 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 37B pseudogene 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-938s1c1
Sequence:CCGGGCAGCGCACTAAGTTACATCTCTCGAGAGATGTAACTTAGTGCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-1447s1c1
Sequence:CCGGGCAATATCTGTGACTGTCATACTCGAGTATGACAGTCACAGATATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-1303s1c1
Sequence:CCGGGCATTGAATGTAGAATGGGATCTCGAGATCCCATTCTACATTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290795.4-1158s1c1
Sequence:CCGGCGAGGATGTGAGAAAGTTCATCTCGAGATGAACTTTCTCACATCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-637s1c1
Sequence:CCGGGCATGTCTAACAGCATACACTCTCGAGAGTGTATGCTGTTAGACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-1006s1c1
Sequence:CCGGCCGTTCACTGAACAGCTATTTCTCGAGAAATAGCTGTTCAGTGAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290795.4-1446s1c1
Sequence:CCGGCGCAATATCTGTGACTGTCATCTCGAGATGACAGTCACAGATATTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290795
LRRC37BP1 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 37B pseudogene 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-938s1c1
Sequence:CCGGGCAGCGCACTAAGTTACATCTCTCGAGAGATGTAACTTAGTGCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-1447s1c1
Sequence:CCGGGCAATATCTGTGACTGTCATACTCGAGTATGACAGTCACAGATATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-1303s1c1
Sequence:CCGGGCATTGAATGTAGAATGGGATCTCGAGATCCCATTCTACATTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290795.4-1158s1c1
Sequence:CCGGCGAGGATGTGAGAAAGTTCATCTCGAGATGAACTTTCTCACATCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-637s1c1
Sequence:CCGGGCATGTCTAACAGCATACACTCTCGAGAGTGTATGCTGTTAGACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290795.4-1006s1c1
Sequence:CCGGCCGTTCACTGAACAGCTATTTCTCGAGAAATAGCTGTTCAGTGAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_290795.4-1446s1c1
Sequence:CCGGCGCAATATCTGTGACTGTCATCTCGAGATGACAGTCACAGATATTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)