EMAIL THIS PAGE TO A FRIEND

LRRC38

leucine rich repeat containing 38

82 Gene Product Result for
Synonyms: RP4-597A16.1
UniProtKB ID: Q5VT99, Q96B32
Gene ID:
Mouse(242735) leucine rich repeat containing 38
Rat(313681) leucine rich repeat containing 38
Zebrafish(567935) leucine rich repeat containing 38
chicken(428194) leucine rich repeat containing 38
domestic cat(101081649) leucine rich repeat containing 38
dog(487434) leucine rich repeat containing 38
naked mole-rat(101722558) leucine rich repeat containing 38
domestic guinea pig(100734167) leucine rich repeat containing 38
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001162983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001713942 Rosetta Predictions human pricing
XM_059074 Rosetta Predictions human pricing
XM_943661 Rosetta Predictions human pricing
NM_001107991 Rosetta Predictions rat pricing
XM_144076 Rosetta Predictions mouse pricing
XM_915579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393938 predicted 1058
2 SASI_Hs02_00393939 predicted 1054
3 SASI_Hs02_00393940 predicted 887
4 SASI_Hs02_00393941 predicted 354
5 SASI_Hs02_00393942 predicted 674
6 SASI_Hs02_00393943 predicted 687
7 SASI_Hs02_00393944 predicted 791
8 SASI_Hs02_00393945 predicted 535
9 SASI_Hs02_00393946 predicted 804
10 SASI_Hs02_00393947 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281674 predicted 1358
2 SASI_Hs01_00281675 predicted 1358
3 SASI_Hs02_00478678 predicted 33
4 SASI_Hs02_00478679 predicted 1622
5 SASI_Hs02_00478680 predicted 1622
6 SASI_Hs01_00281678 predicted 977
7 SASI_Hs02_00478681 predicted 1581
8 SASI_Hs02_00478682 predicted 1484
9 SASI_Hs02_00478683 predicted 18
10 SASI_Hs01_00281683 predicted 1110
11 SASI_Hs01_00281676 predicted 1269
12 SASI_Hs01_00281677 predicted 735
13 SASI_Hs01_00281679 predicted 1071
14 SASI_Hs01_00281680 predicted 1176
15 SASI_Hs01_00281681 predicted 1512
16 SASI_Hs01_00281682 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_943661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00486125 predicted 1320
2 SASI_Hs02_00486126 predicted 1319
3 SASI_Hs02_00486127 predicted 1147
4 SASI_Hs02_00486128 predicted 613
5 SASI_Hs02_00486129 predicted 935
6 SASI_Hs02_00486130 predicted 950
7 SASI_Hs02_00486131 predicted 1044
8 SASI_Hs02_00486132 predicted 799
9 SASI_Hs02_00486133 predicted 1062
10 SASI_Hs02_00486134 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234285 predicted 885
2 SASI_Rn02_00234286 predicted 1782
3 SASI_Rn02_00234287 predicted 898
4 SASI_Rn02_00234288 predicted 861
5 SASI_Rn02_00234289 predicted 1784
6 SASI_Rn02_00234290 predicted 974
7 SASI_Rn02_00234291 predicted 1781
8 SASI_Rn02_00234292 predicted 642
9 SASI_Rn02_00234293 predicted 732
10 SASI_Rn02_00234294 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271864 predicted 1702
2 SASI_Mm01_00271865 predicted 1782
3 SASI_Mm01_00271866 predicted 1798
4 SASI_Mm01_00271867 predicted 1637
5 SASI_Mm01_00271868 predicted 1544
6 SASI_Mm01_00271869 predicted 1627
7 SASI_Mm01_00271871 predicted 1466
8 SASI_Mm01_00271872 predicted 1492
9 SASI_Mm01_00271873 predicted 1549
10 SASI_Mm02_00425217 predicted 1362
11 SASI_Mm01_00271870 predicted 1483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439597 predicted 1127
2 SASI_Mm02_00439598 predicted 1128
3 SASI_Mm02_00439599 predicted 1397
4 SASI_Mm02_00439600 predicted 1466
5 SASI_Mm02_00439601 predicted 1124
6 SASI_Mm02_00439602 predicted 670
7 SASI_Mm02_00439603 predicted 1404
8 SASI_Mm02_00439604 predicted 1163
9 SASI_Mm02_00439605 predicted 1001
10 SASI_Mm02_00439606 predicted 1327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162983
LRRC38 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 38
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000346826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162983.1-664s21c1
Sequence:CCGGTCCATGGAGATCTGGTGTATCCTCGAGGATACACCAGATCTCCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162983.1-1157s21c1
Sequence:CCGGCCTGTCTCTCACAGACCTATTCTCGAGAATAGGTCTGTGAGAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162983.1-1641s21c1
Sequence:CCGGAGTTGTTTGGGCCGTTCTTATCTCGAGATAAGAACGGCCCAAACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162983.1-1119s21c1
Sequence:CCGGGAGCTATCCGAAGCTAGTTTCCTCGAGGAAACTAGCTTCGGATAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162983
LRRC38 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 38
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000346826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162983.1-664s21c1
Sequence:CCGGTCCATGGAGATCTGGTGTATCCTCGAGGATACACCAGATCTCCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162983.1-1157s21c1
Sequence:CCGGCCTGTCTCTCACAGACCTATTCTCGAGAATAGGTCTGTGAGAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162983.1-1641s21c1
Sequence:CCGGAGTTGTTTGGGCCGTTCTTATCTCGAGATAAGAACGGCCCAAACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162983.1-1119s21c1
Sequence:CCGGGAGCTATCCGAAGCTAGTTTCCTCGAGGAAACTAGCTTCGGATAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162983
LRRC38 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 38
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000346826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162983.1-664s21c1
Sequence:CCGGTCCATGGAGATCTGGTGTATCCTCGAGGATACACCAGATCTCCATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162983.1-1157s21c1
Sequence:CCGGCCTGTCTCTCACAGACCTATTCTCGAGAATAGGTCTGTGAGAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162983.1-1641s21c1
Sequence:CCGGAGTTGTTTGGGCCGTTCTTATCTCGAGATAAGAACGGCCCAAACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162983.1-1119s21c1
Sequence:CCGGGAGCTATCCGAAGCTAGTTTCCTCGAGGAAACTAGCTTCGGATAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)