EMAIL THIS PAGE TO A FRIEND

LRRC39

leucine rich repeat containing 39

68 Gene Product Result for
UniProtKB ID: Q96DD0, B3KUD2, D3DT56, Q5VVK7
Gene ID:
Mouse(109245) leucine rich repeat containing 39
Rat(691307) leucine rich repeat containing 39
sheep(101113112) leucine rich repeat containing 39
domestic guinea pig(100722124) leucine rich repeat containing 39
naked mole-rat(101721708) leucine rich repeat containing 39
Zebrafish(550456) leucine rich repeat containing 39
chicken(424469) leucine rich repeat containing 39
cow(616488) leucine rich repeat containing 39
domestic cat(101087083) leucine rich repeat containing 39
dog(490141) leucine rich repeat containing 39
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144620 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039991 MISSION® esiRNA esiRNA human LRRC39 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144620 Rosetta Predictions human pricing
NM_001109637 Rosetta Predictions rat pricing
NM_027321 Rosetta Predictions mouse pricing
NM_175413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097248 predicted 567
2 SASI_Hs01_00097249 predicted 1025
3 SASI_Hs02_00364442 predicted 1086
4 SASI_Hs01_00097250 predicted 870
5 SASI_Hs01_00097251 predicted 400
6 SASI_Hs01_00097252 predicted 816
7 SASI_Hs01_00097253 predicted 998
8 SASI_Hs01_00097254 predicted 341
9 SASI_Hs01_00097255 predicted 675
10 SASI_Hs01_00097257 predicted 539
11 SASI_Hs01_00097256 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250302 predicted 552
2 SASI_Rn02_00250303 predicted 1113
3 SASI_Rn02_00250304 predicted 1138
4 SASI_Rn02_00250305 predicted 1064
5 SASI_Rn02_00250306 predicted 1264
6 SASI_Rn02_00250307 predicted 410
7 SASI_Rn02_00250308 predicted 501
8 SASI_Rn02_00250309 predicted 598
9 SASI_Rn02_00250310 predicted 878
10 SASI_Rn02_00250311 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178695 predicted 289
2 SASI_Mm01_00178696 predicted 328
3 SASI_Mm01_00178697 predicted 249
4 SASI_Mm01_00178698 predicted 215
5 SASI_Mm01_00178699 predicted 216
6 SASI_Mm01_00178700 predicted 400
7 SASI_Mm01_00178701 predicted 258
8 SASI_Mm01_00178702 predicted 247
9 SASI_Mm01_00178703 predicted 401
10 SASI_Mm01_00178704 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048473 predicted 336
2 SASI_Mm01_00048474 predicted 389
3 SASI_Mm01_00048475 predicted 307
4 SASI_Mm01_00048476 predicted 267
5 SASI_Mm01_00048477 predicted 264
6 SASI_Mm01_00048478 predicted 451
7 SASI_Mm01_00048479 predicted 322
8 SASI_Mm01_00048480 predicted 299
9 SASI_Mm01_00048481 predicted 451
10 SASI_Mm01_00048482 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144620
LRRC39 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 39
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-322s21c1
Sequence:CCGGGATCTGGGAAGAACGAGTAAGCTCGAGCTTACTCGTTCTTCCCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-519s21c1
Sequence:CCGGACCTCATTGTGTTAGATTTATCTCGAGATAAATCTAACACAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-742s21c1
Sequence:CCGGTGATCTGAGTATGAACGATTTCTCGAGAAATCGTTCATACTCAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-875s21c1
Sequence:CCGGACGTTATGGCTGCAACGAAATCTCGAGATTTCGTTGCAGCCATAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-1079s21c1
Sequence:CCGGGAAGAAGAGGAACGGGAATTACTCGAGTAATTCCCGTTCCTCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144620
LRRC39 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 39
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-322s21c1
Sequence:CCGGGATCTGGGAAGAACGAGTAAGCTCGAGCTTACTCGTTCTTCCCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-519s21c1
Sequence:CCGGACCTCATTGTGTTAGATTTATCTCGAGATAAATCTAACACAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-742s21c1
Sequence:CCGGTGATCTGAGTATGAACGATTTCTCGAGAAATCGTTCATACTCAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-875s21c1
Sequence:CCGGACGTTATGGCTGCAACGAAATCTCGAGATTTCGTTGCAGCCATAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-1079s21c1
Sequence:CCGGGAAGAAGAGGAACGGGAATTACTCGAGTAATTCCCGTTCCTCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144620
LRRC39 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 39
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-322s21c1
Sequence:CCGGGATCTGGGAAGAACGAGTAAGCTCGAGCTTACTCGTTCTTCCCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-519s21c1
Sequence:CCGGACCTCATTGTGTTAGATTTATCTCGAGATAAATCTAACACAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-742s21c1
Sequence:CCGGTGATCTGAGTATGAACGATTTCTCGAGAAATCGTTCATACTCAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-875s21c1
Sequence:CCGGACGTTATGGCTGCAACGAAATCTCGAGATTTCGTTGCAGCCATAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144620.2-1079s21c1
Sequence:CCGGGAAGAAGAGGAACGGGAATTACTCGAGTAATTCCCGTTCCTCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175413
LRRC39 MISSION shRNA Bacterial Glycerol Stock
leucine rich repeat containing 39
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175413.1-1457s1c1
Sequence:CCGGGCCTTGGTCAATCAGCAGTTTCTCGAGAAACTGCTGATTGACCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-1090s1c1
Sequence:CCGGGCAGTTTATGCACGCATACATCTCGAGATGTATGCGTGCATAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-833s1c1
Sequence:CCGGCTAGACAGAATGCGAAGTTTACTCGAGTAAACTTCGCATTCTGTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-1087s1c1
Sequence:CCGGGCTGCAGTTTATGCACGCATACTCGAGTATGCGTGCATAAACTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-498s1c1
Sequence:CCGGAGCATCTCATTGTGCTAGATTCTCGAGAATCTAGCACAATGAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175413
LRRC39 MISSION shRNA shRNA Plasmid DNA
leucine rich repeat containing 39
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175413.1-1457s1c1
Sequence:CCGGGCCTTGGTCAATCAGCAGTTTCTCGAGAAACTGCTGATTGACCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-1090s1c1
Sequence:CCGGGCAGTTTATGCACGCATACATCTCGAGATGTATGCGTGCATAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-833s1c1
Sequence:CCGGCTAGACAGAATGCGAAGTTTACTCGAGTAAACTTCGCATTCTGTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-1087s1c1
Sequence:CCGGGCTGCAGTTTATGCACGCATACTCGAGTATGCGTGCATAAACTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-498s1c1
Sequence:CCGGAGCATCTCATTGTGCTAGATTCTCGAGAATCTAGCACAATGAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175413
LRRC39 MISSION shRNA Lentiviral Transduction Particles
leucine rich repeat containing 39
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175413.1-1457s1c1
Sequence:CCGGGCCTTGGTCAATCAGCAGTTTCTCGAGAAACTGCTGATTGACCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-1090s1c1
Sequence:CCGGGCAGTTTATGCACGCATACATCTCGAGATGTATGCGTGCATAAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-833s1c1
Sequence:CCGGCTAGACAGAATGCGAAGTTTACTCGAGTAAACTTCGCATTCTGTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-1087s1c1
Sequence:CCGGGCTGCAGTTTATGCACGCATACTCGAGTATGCGTGCATAAACTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175413.1-498s1c1
Sequence:CCGGAGCATCTCATTGTGCTAGATTCTCGAGAATCTAGCACAATGAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)